ORFeome > lfng ORF1 – XORFeome v1.0

lfng ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lfng
Gene ID: 865754
Gene Page ID: 487974
ORF Xenbase ID: 17282067

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129688
Original XGC clone length: 1122

Human orthology & disease relationships

NCBI Entrez ID: 3955
Ensembl gene IDs: ENSG00000106003
Directly associated (OMIM) disease MIM numbers: 609813
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,125310,277300,609813

Library Location

Plate ID: GDExl11090
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ838672
dbEST ID: 79656374
Trimmed Sequence: ATGCTGAAGAACTGCGGGAAGAAGCTGCTGTTGTCTATGGTGGGCGCAACTCTCACCTGCCTGCTGGTGCTCGTGGTGGATCAACATCAGAACCGGCAGATGCTGGAGACCCAGAGCGCAGAGGAGCCCGGCGCTGTCCATTTACGGGCAGACTTGGACCCTGCCAAACCCGGGGATGCGGGAGAGCCTGCTAAGGACGCCCAGGATGCCAGTACCTTCTCGGCTTATTTCAACAAGCTCACCAGGGTGAGGAGAGACGTGGAGCAGGTGGCGACCCCATCCAAAGAGTCCCAGGCTCCCGTGGAAGACATCACCGCCAACGATGTGTTCATCGCCGTCAAGACCACCAAGAAATTCCATCGATCCCGAATGGACCTGCTGATGGACACGTGGATCTCCAGAAACAAGCAGCAAACTTTCATCTTCACTGATGGGGAGGACGAAGAGCTTCAGAAAAAGACAGGCAATGTCATTAGTACAAACTGCTCAGCTGCTCACAGCCGCCAAGCCCTTTCCTGCAAGATGGCAGTGGAATATGACAAGTTCATGGAGTCTGATAAAAAGTGGTTCTGCCATGTTGATGATGATAACTATGTAAATGTCCGGACGCTAATTGAAACTGCTGTCTCGTTACTTCCCACCCCAATAAAATTTACATTTGGAAGGCCGAGCCTTAAACCGCCCAATCCAACCTACAAAAAAGAATCAATGAAAAAGAATAATGCCCCCCTGGTCCAATTTTTTGGTTTTGGCTACTGGAAAAAACCTGGGGTT
Full Trace Sequence: CTCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGAAGAACTGCGGGAAGAAGCTGCTGTTGTCTATGGTGGGCGCAACTCTCACCTGCCTGCTGGTGCTCGTGGTGGATCAACATCAGAACCGGCAGATGCTGGAGACCCAGAGCGCAGAGGAGCCCGGCGCTGTCCATTTACGGGCAGACTTGGACCCTGCCAAACCCGGGGATGCGGGAGAGCCTGCTAAGGACGCCCAGGATGCCAGTACCTTCTCGGCTTATTTCAACAAGCTCACCAGGGTGAGGAGAGACGTGGAGCAGGTGGCGACCCCATCCAAAGAGTCCCAGGCTCCCGTGGAAGACATCACCGCCAACGATGTGTTCATCGCCGTCAAGACCACCAAGAAATTCCATCGATCCCGAATGGACCTGCTGATGGACACGTGGATCTCCAGAAACAAGCAGCAAACTTTCATCTTCACTGATGGGGAGGACGAAGAGCTTCAGAAAAAGACAGGCAATGTCATTAGTACAAACTGCTCAGCTGCTCACAGCCGCCAAGCCCTTTCCTGCAAGATGGCAGTGGAATATGACAAGTTCATGGAGTCTGATAAAAAGTGGTTCTGCCATGTTGATGATGATAACTATGTAAATGTCCGGACGCTAATTGAAACTGCTGTCTCGTTACTTCCCACCCCAATAAAATTTACATTTGGAAGGCCGAGCCTTAAACCGCCCAATCCAACCTACAAAAAAGAATCAATGAAAAAGAATAATGCCCCCCTGGTCCAATTTTTTGGTTTTGGCTACTGGAAAAAACCTGGGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGAAGAACTGCGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838671
dbEST ID: 79656373
Trimmed Sequence: GTAAGCAGCTTTCCACGGACACCAGGGAGTATCTGGGTATAGTAGGCAATGTACAGAACGGAACCGAGAAGGATCTTCCTCTACTGAAAAGGCACCCTTCATCAAAATGGCGTTCCTCTTGTTTTCAAACATCCCATAACTTAATGTCACCTGATTGTGGATCTCACTCTGGGGAACTTGATGCAGATTTTCCAAATGTGAATGGAAGAGGTTACTACGGATGAGTTTCACTCCCAACACAGACTCAATGATATAACCAATGGTGCAGTCATCAGGGAGTCTGATCTTTTCTGCTGTATTCATGAAATGCCCTCCACTTGCCCATGGACTCATTTTAAGGGCCAACCCACGGCTAATACAGAAGCCAGCTCCTCCAGTAGCAAACCAAAAATTGACAGGGCGCATATTGCTCTCACTGATCCTCTCTGTAGCTTGGATAGGCCGGTCTAAGCTCGGCTTCCCAATGTAAATATCATTGGTGTGGGAGTAACGAGACAGCAGTTTCACTAGCGTCCGGACATTTACATAGTTATCATCATCAACATGGCAGAACCACTTCTTATCAAACTCCATGAACTTGTCATATTCCACTGCCATCTTTGCAGGAAAGGGCTTGGCGGCTGTGAGCAGCTGGAACATTTTTGACTAATGAAATTTCCTGTCTTTTTCCGGAACCCTCTTCCTCCTCCCCATCAATTGAAAAATAAAAAGTTTTGCCTGCCTGGTTTTCGGGGAAAAACCCGCGTTGTCCCCGTTACCAGGGGTCC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAAGCAGCTTTCCACGGACACCAGGGAGTATCTGGGTATAGTAGGCAATGTACAGAACGGAACCGAGAAGGATCTTCCTCTACTGAAAAGGCACCCTTCATCAAAATGGCGTTCCTCTTGTTTTCAAACATCCCATAACTTAATGTCACCTGATTGTGGATCTCACTCTGGGGAACTTGATGCAGATTTTCCAAATGTGAATGGAAGAGGTTACTACGGATGAGTTTCACTCCCAACACAGACTCAATGATATAACCAATGGTGCAGTCATCAGGGAGTCTGATCTTTTCTGCTGTATTCATGAAATGCCCTCCACTTGCCCATGGACTCATTTTAAGGGCCAACCCACGGCTAATACAGAAGCCAGCTCCTCCAGTAGCAAACCAAAAATTGACAGGGCGCATATTGCTCTCACTGATCCTCTCTGTAGCTTGGATAGGCCGGTCTAAGCTCGGCTTCCCAATGTAAATATCATTGGTGTGGGAGTAACGAGACAGCAGTTTCACTAGCGTCCGGACATTTACATAGTTATCATCATCAACATGGCAGAACCACTTCTTATCAAACTCCATGAACTTGTCATATTCCACTGCCATCTTTGCAGGAAAGGGCTTGGCGGCTGTGAGCAGCTGGAACATTTTTGACTAATGAAATTTCCTGTCTTTTTCCGGAACCCTCTTCCTCCTCCCCATCAATTGAAAAATAAAAAGTTTTGCCTGCCTGGTTTTCGGGGAAAAACCCGCGTTGTCCCCGTTACCAGGGGTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAGCAGCTTTCCACGGACA