ORFeome > lgals1 ORF1 – XORFeome v1.0

lgals1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lgals1
Gene ID: 971981
Gene Page ID: 971977
ORF Xenbase ID: 17282073

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053816
Original XGC clone length: 405

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ839120
dbEST ID: 79656822
Trimmed Sequence: ATGGCAGCTGGAATGGTCATGAATAACTTTAGCCTGAAGCAGGGCCACTGCTTGGAACTGAAAGGTTTTATTCCCAAAGATGCTAAAAGCTTTGCAATAAACCTGGGCAAAGATAGTTCAAACTATGTCATTCACTTTAATCCTCGATTCGACCACGAAGGCGACACCAACAAAATAATCTGCAACTCAAAGGAAGAAAACAGCTGGGGGACAGAGCAGAGAGAAAATGTTTTCCCATTCCAGCAGGGAGCAGAGACATCGATTTGTTTTGAGTATCAAGCAGACCATTTAAAGGTGAAGTTATCTGATGGCCAAGAATTCAACTTCCCCATCCGAATGCCCTTGGATACCATTACATTCCTTTCTATGGATGGAATAGAGCTCAAGGCTATCTCTCTTCATTT
Full Trace Sequence: GGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGGAATGGTCATGAATAACTTTAGCCTGAAGCAGGGCCACTGCTTGGAACTGAAAGGTTTTATTCCCAAAGATGCTAAAAGCTTTGCAATAAACCTGGGCAAAGATAGTTCAAACTATGTCATTCACTTTAATCCTCGATTCGACCACGAAGGCGACACCAACAAAATAATCTGCAACTCAAAGGAAGAAAACAGCTGGGGGACAGAGCAGAGAGAAAATGTTTTCCCATTCCAGCAGGGAGCAGAGACATCGATTTGTTTTGAGTATCAAGCAGACCATTTAAAGGTGAAGTTATCTGATGGCCAAGAATTCAACTTCCCCATCCGAATGCCCTTGGATACCATTACATTCCTTTCTATGGATGGAATAGAGCTCAAGGCTATCTCTCTTCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAAATGGTCATAGCTGTTTCCTGGCAAATCAAAAAAATGTCTCAAAATCTCTGATGTAACAGNCNCNNCCNGGGCGGGNTTGCTGTNNNTGGGTCGCTCCTCGCGCGGGGGGCAAAAAAAAAATNAATAAAATAGATGATAAAACAACCCCACGCACAAAACACGAACACGGGCGCGCGGGGTGAAATGAGGGTTACAAAACGGCCCCCGCCCGCGCGTGCGGGAAGTACCGCAAAGAGGAACCCCAGGGNGAAAAGGANGAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGGAATGGTCATGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839119
dbEST ID: 79656821
Trimmed Sequence: ATGAAGAGAGATAGCCTTGAGCTCTATTCCATCCATAGAAAGGAATGTAATGGTATCCAAGGGCATTCGGATGGGGAAGTTGAATTCTTGGCCATCAGATAACTTCACCTTTAAATGGTCTGCTTGATACTCAAAACAAATCGATGTCTCTGCTCCCTGCTGGAATGGGAAAACATTTTCTCTCTGCTCTGTCCCCCAGCTGTTTTCTTCCTTTGAGTTGCAGATTATTTTGTTGGTGTCGCCTTCGTGGTCGAATCGAGGATTAAAGTGAATGACATAGTTTGAACTATCTTTGCCCAGGTTTATTGCAAAGCTTTTAGCATCTTTGGGAATAAAACCTTTCAGTTCCAAGCAGTGGCCCTGCTTCAGGCTAAAGTTATTCATGACCATTCCAGCTGCCATGG
Full Trace Sequence: GCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGAAGAGAGATAGCCTTGAGCTCTATTCCATCCATAGAAAGGAATGTAATGGTATCCAAGGGCATTCGGATGGGGAAGTTGAATTCTTGGCCATCAGATAACTTCACCTTTAAATGGTCTGCTTGATACTCAAAACAAATCGATGTCTCTGCTCCCTGCTGGAATGGGAAAACATTTTCTCTCTGCTCTGTCCCCCAGCTGTTTTCTTCCTTTGAGTTGCAGATTATTTTGTTGGTGTCGCCTTCGTGGTCGAATCGAGGATTAAAGTGAATGACATAGTTTGAACTATCTTTGCCCAGGTTTATTGCAAAGCTTTTAGCATCTTTGGGAATAAAACCTTTCAGTTCCAAGCAGTGGCCCTGCTTCAGGCTAAAGTTATTCATGACCATTCCAGCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTTCCCATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCAAAAGACAGGCAGGTCGTTTAAAACGACTTGACTGGGATTATCCTAGGCGCCCTCGGCCGTGACCGGAATTGCCGGAAAACAAAAAAAAAAAAAGTGGGGAAAAAGTTCAGATACTGTGATATAGTGGCNNAGAGATGGTGGAGAANTAAGAAANTGGGTCGTCGAGTATGCCATTTGGTTATGAGCTCTTTTTATAAGAAGGCATTTGTTGGAGGTGTTAGTGTGATGGGTGTCCGTTTTTATGTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGAAGAGAGATAGCCTTGAG