ORFeome > lgals8 ORF1 – XORFeome v1.0

lgals8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lgals8
Gene ID: 866367
Gene Page ID: 494604
ORF Xenbase ID: 17282097

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129737
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ838950
dbEST ID: 79656652
Trimmed Sequence: ATGGCCCAAACAGGACTTCAGCGAACTATTATGGATCCGGTTGTGCCTTATGTGGGGACTATTTTTGGTGGCCTGGAACCAGGACAGATGATCGTAATACATGGGACTGTCCATCCTGATGCAGATCGATTTCAGATAGACTTCCAGCGTGGAAACAGTGTCCAGCCTCGTTCTGATGTGGCTTTTCACTTCAACCCTCGTTTTAAAGGGTCCGGACACATCGTATGTAACACTCTAGAGAACGAAAAATGGGGATGGGAGGAAAAAACATACCAAATGCCATTTACGAAGGGGCGACCATTTGAAATCATATTCTTGGTCTTTCACGATAAATTTCAGGTGTCTTCAAATGGAAGAAATCTACTTGTTTACATACACAGAATCAGTCTACAACGAGTTGATACTTTGGGCATATCTGGTAGAGTGAAGATTAATACAATTGGATTCTTATCTCAACCAACACTTCTTGTTTCGCGTCCAACATCTCTTGCATGAGGCAGCATCGAAGCAAACAGGGGAGGAGGAGAAAAACCACGGAACGTTAATATTCCTTATCCAGGTTGCCGGCCTACTCCTCTGATCCCTCCGAGGAGGGGGATGATTTGGGAAAAGTGGGTCAAGATTCCTAAAAGATTTGAGGTGTTGGTGGAGTGGTAAAAACACCCGGGGGTAGGGAGAGATATGAATTAAAAAATAAAAAAAAAAGACGAAAAGGGGGGGGGGGGGGGGAAAATATATCTCTTTGCCCCACCCCGGGGGGGGAGGGGAGAAAAAAATGGGGGGGAGGCACTCTATCTGTTGGTCTGGGGGTCTCTTTCTGTTATT
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCAAACAGGACTTCAGCGAACTATTATGGATCCGGTTGTGCCTTATGTGGGGACTATTTTTGGTGGCCTGGAACCAGGACAGATGATCGTAATACATGGGACTGTCCATCCTGATGCAGATCGATTTCAGATAGACTTCCAGCGTGGAAACAGTGTCCAGCCTCGTTCTGATGTGGCTTTTCACTTCAACCCTCGTTTTAAAGGGTCCGGACACATCGTATGTAACACTCTAGAGAACGAAAAATGGGGATGGGAGGAAAAAACATACCAAATGCCATTTACGAAGGGGCGACCATTTGAAATCATATTCTTGGTCTTTCACGATAAATTTCAGGTGTCTTCAAATGGAAGAAATCTACTTGTTTACATACACAGAATCAGTCTACAACGAGTTGATACTTTGGGCATATCTGGTAGAGTGAAGATTAATACAATTGGATTCTTATCTCAACCAACACTTCTTGTTTCGCGTCCAACATCTCTTGCATGAGGCAGCATCGAAGCAAACAGGGGAGGAGGAGAAAAACCACGGAACGTTAATATTCCTTATCCAGGTTGCCGGCCTACTCCTCTGATCCCTCCGAGGAGGGGGATGATTTGGGAAAAGTGGGTCAAGATTCCTAAAAGATTTGAGGTGTTGGTGGAGTGGTAAAAACACCCGGGGGTAGGGAGAGATATGAATTAAAAAATAAAAAAAAAAGACGAAAAGGGGGGGGGGGGGGGGAAAATATATCTCTTTGCCCCACCCCGGGGGGGGAGGGGAGAAAAAAATGGGGGGGAGGCACTCTATCTGTTGGTCTGGGGGTCTCTTTCTGTTATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCAAACAGGACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838949
dbEST ID: 79656651
Trimmed Sequence: CCAGATGCGCACATCATGTAGTTGAATATCACCATTCACAGAAACCTCATTGATCTTATTCAGATCTTTGAATCTGTGCTTATATTCCAGCAGATGCACTCCATTTACAGCAACCCTGAACTGCTGTAGATCACAGTAGATGAGAATCTCAAAGTACATTTCTGTGCAAAATGGAAAGTCCAGCAGCTGTTTCTCCTCTTCCCCCCAGCTTTCACGCAGATATGTGTTCCTCACAAACACCCTTTCTTTCATTCGTGGATTCAGATGTAATGCAATATCCTTGGAACCGTGTGGCTTCAGATCAATGGCAAACCTCTTAGCATTCTTGAGTACTTCTCCTTTAATCACCATAGTCTTCCCAGGGATTAGAGGACTAGGAAGGCAACCTGTATAAGGAATAGTAAAGTTCCGCGGTTTTTCTGATCCTCCCTTGTTTGCTTCGATGCTGTTTCCTGCAAGAGATGTTGGCTGTGAACCAAGAAGTGTTGGTTGAGCTAAGAATCCAATCGTATTAATCTTCACTTTACCAGATATGCCCAAAGTATCAACTCGTTGTAGACTGATTCTGTGTTTGTAAACCAGTAGATTTTTTCCATTTGAAGACACCTGAAATTTATCGTGAAAGACCAAAAATATAATTTCAAATGGTTCCCCTTCGTAAATGGCAGTTGGGAGGGTTTTTTCCTCCCATCCCCCCTTTTTCCTTTCCCTAGATTGTTTTCATACCAAAGGGGTCCGGAACCTTTTAAAAACCCGAGGGGTTTTAAATTG
Full Trace Sequence: GGCAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGATGCGCACATCATGTAGTTGAATATCACCATTCACAGAAACCTCATTGATCTTATTCAGATCTTTGAATCTGTGCTTATATTCCAGCAGATGCACTCCATTTACAGCAACCCTGAACTGCTGTAGATCACAGTAGATGAGAATCTCAAAGTACATTTCTGTGCAAAATGGAAAGTCCAGCAGCTGTTTCTCCTCTTCCCCCCAGCTTTCACGCAGATATGTGTTCCTCACAAACACCCTTTCTTTCATTCGTGGATTCAGATGTAATGCAATATCCTTGGAACCGTGTGGCTTCAGATCAATGGCAAACCTCTTAGCATTCTTGAGTACTTCTCCTTTAATCACCATAGTCTTCCCAGGGATTAGAGGACTAGGAAGGCAACCTGTATAAGGAATAGTAAAGTTCCGCGGTTTTTCTGATCCTCCCTTGTTTGCTTCGATGCTGTTTCCTGCAAGAGATGTTGGCTGTGAACCAAGAAGTGTTGGTTGAGCTAAGAATCCAATCGTATTAATCTTCACTTTACCAGATATGCCCAAAGTATCAACTCGTTGTAGACTGATTCTGTGTTTGTAAACCAGTAGATTTTTTCCATTTGAAGACACCTGAAATTTATCGTGAAAGACCAAAAATATAATTTCAAATGGTTCCCCTTCGTAAATGGCAGTTGGGAGGGTTTTTTCCTCCCATCCCCCCTTTTTCCTTTCCCTAGATTGTTTTCATACCAAAGGGGTCCGGAACCTTTTAAAAACCCGAGGGGTTTTAAATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGATGCGCACATCATGTAGTT