ORFeome > lgmn ORF1 – XORFeome v1.0

lgmn ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lgmn
Gene ID: 950610
Gene Page ID: 950604
ORF Xenbase ID: 17282133

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056842
Original XGC clone length: 1302

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ839307
dbEST ID: 79657009
Trimmed Sequence: ATGTTTCTACATCTGGCAGCACTGGTAAGCTTCGTTTTAGGAGCCTCATCTGTGCCATTCAGCAACCCAGAGGATACAGGAAAGCACTGGGTGGTCCTTGTTGCAGGTTCCAATGGCTGGTACAACTACCGACATCAGGCAGATGTGTGCCATGCCTATCAAATAGTCAAGAAGAATGGCATCCCTGATGAGCAGATTGTCGTCATGATGTATGATGATATTGCCAATAATGATGAAAATCCTACCAAAGGAGTCATTATCAACAGGCCCAATGGTACTGACGTTTATGCTGGAGTCCTGAAGGATTATATTGGAGATGATGTCAACCCTAAAAATTTTCTGGCTGTTCTGAGTGGTGATTCTGAAGCCGTCAAGGGGAAAGGATCGGGGAAAGTAATCCGCAGTGGCCCCAATGATCACGTGTTTGTATACTTTACAGACCACGGAGCACCAGGCCTGCTGGCCTTTCCTAGTGATGATCTGCATGTTATGGAACTGAATAAGACCATACAGCATATGTATGAGAACAAGAAGTACAAAAAGATGGTGTTTTACATTGAGGCCTGTGAGTCTGGCTCCATGATGAACCACCTGCCCAATAATATTAATGTATACGCAACCACAGCTGCCAACCCCCCAGAGTCCTCCTATGCTTGTTAACATGACGACAAACGTGACACTTACCTGGGGAGATCTATTAAGTGGTTACCTGGAAGGAAAAACTCTAAATATGGAAGAACTTGGCCCAAAAAAACCCTAACCCAAACAATTTTTTTTCGGGGTGAAACCGCCCCCACGAAACACCAAACCCCTGGTTCA
Full Trace Sequence: CGAGGGCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCTACATCTGGCAGCACTGGTAAGCTTCGTTTTAGGAGCCTCATCTGTGCCATTCAGCAACCCAGAGGATACAGGAAAGCACTGGGTGGTCCTTGTTGCAGGTTCCAATGGCTGGTACAACTACCGACATCAGGCAGATGTGTGCCATGCCTATCAAATAGTCAAGAAGAATGGCATCCCTGATGAGCAGATTGTCGTCATGATGTATGATGATATTGCCAATAATGATGAAAATCCTACCAAAGGAGTCATTATCAACAGGCCCAATGGTACTGACGTTTATGCTGGAGTCCTGAAGGATTATATTGGAGATGATGTCAACCCTAAAAATTTTCTGGCTGTTCTGAGTGGTGATTCTGAAGCCGTCAAGGGGAAAGGATCGGGGAAAGTAATCCGCAGTGGCCCCAATGATCACGTGTTTGTATACTTTACAGACCACGGAGCACCAGGCCTGCTGGCCTTTCCTAGTGATGATCTGCATGTTATGGAACTGAATAAGACCATACAGCATATGTATGAGAACAAGAAGTACAAAAAGATGGTGTTTTACATTGAGGCCTGTGAGTCTGGCTCCATGATGAACCACCTGCCCAATAATATTAATGTATACGCAACCACAGCTGCCAACCCCCCAGAGTCCTCCTATGCTTGTTAACATGACGACAAACGTGACACTTACCTGGGGAGATCTATTAAGTGGTTACCTGGAAGGAAAAACTCTAAATATGGAAGAACTTGGCCCAAAAAAACCCTAACCCAAACAATTTTTTTTCGGGGTGAAACCGCCCCCACGAAACACCAAACCCCTGGTTCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCTACATCTGGCAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839306
dbEST ID: 79657008
Trimmed Sequence: GTTCCAACTGTTACACACTTTTTCCATTGCCTTGTGGACTCTTTCTATGGGATATCCAGACTCACACAGATTGACCAGAGCATAGAGGTTTCTCAGAGCATATTCATACAGAGGATTGTGCCAGTTAAAGCACTGTCTTTTGAAGTGTTCGGCTGCATCCCGATAACACTGCGTGTCATTAATGATAACCTGGTCAGTCAGTATTTCTTCTGTGAGCTCATCCGATTCTGTCACCATGTTTACAATTTTCCTCATAGACTCTTTTATCAGTTGTTTTGCCTCTTGGTGTGCTTTGATCTCTCTCACAATAGCTCTGGCTTGCAGAATGTCATTTGTGGCCATCAGTTTTCTTTTTAGGATTGCTAGAGGTACATCAGGGCTGGGAGTCAAGTCCATATGTTTTACAGGCTCTAGATACACAGGTGTGGAAGTGATCTTTACATTGCCCTGGAACTGATTCACTTTCATCTGTGATATTGTCCTGTTTCCATACTGCATGACATGGCTAGTGTTCGTGTGCTGCTTCACCAGAACAAACTGTTTGTGTAGTGTTTCTTTGGCCAAGTCCTCCATATCAGAGTCTTCCATCCCGCTAACACTGTATAGATCTCCCAGGTAAGTGTCACGTTTGTCGTCATAGTAACAAGCATAGGAGGACTCCCGGGGGTTGGGCAGCTGTGGTTGCGTTAAACTTTAATATTATTTGGGCAAGGTGGTTTCATCCTGGGAACCCCGAACTCCCAAAGGCCTCAAAGGTAAAAAAAAC
Full Trace Sequence: CCGTGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCCAACTGTTACACACTTTTTCCATTGCCTTGTGGACTCTTTCTATGGGATATCCAGACTCACACAGATTGACCAGAGCATAGAGGTTTCTCAGAGCATATTCATACAGAGGATTGTGCCAGTTAAAGCACTGTCTTTTGAAGTGTTCGGCTGCATCCCGATAACACTGCGTGTCATTAATGATAACCTGGTCAGTCAGTATTTCTTCTGTGAGCTCATCCGATTCTGTCACCATGTTTACAATTTTCCTCATAGACTCTTTTATCAGTTGTTTTGCCTCTTGGTGTGCTTTGATCTCTCTCACAATAGCTCTGGCTTGCAGAATGTCATTTGTGGCCATCAGTTTTCTTTTTAGGATTGCTAGAGGTACATCAGGGCTGGGAGTCAAGTCCATATGTTTTACAGGCTCTAGATACACAGGTGTGGAAGTGATCTTTACATTGCCCTGGAACTGATTCACTTTCATCTGTGATATTGTCCTGTTTCCATACTGCATGACATGGCTAGTGTTCGTGTGCTGCTTCACCAGAACAAACTGTTTGTGTAGTGTTTCTTTGGCCAAGTCCTCCATATCAGAGTCTTCCATCCCGCTAACACTGTATAGATCTCCCAGGTAAGTGTCACGTTTGTCGTCATAGTAACAAGCATAGGAGGACTCCCGGGGGTTGGGCAGCTGTGGTTGCGTTAAACTTTAATATTATTTGGGCAAGGTGGTTTCATCCTGGGAACCCCGAACTCCCAAAGGCCTCAAAGGTAAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCCAACTGTTACACACTTTTTC