ORFeome > lipt1 ORF1 – XORFeome v1.0

lipt1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lipt1
Gene ID: 990772
Gene Page ID: 990768
ORF Xenbase ID: 17282229

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078584
Original XGC clone length: 1065

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ839612
dbEST ID: 79657314
Trimmed Sequence: ATGATCATCAGGCCAATGATCAGAAGTTTCCATTCCTTGTTTGCTTTACGCATCATACCAGCCAGATATGAAAGTTCTGTAAAAGAAGGTGTCATTTTGCAATCTACATCGAACAACGTTTATGAAAACTTAGCTATTGAAGACTGGATTCATGATCAAATGAACCTAGAAAACAAGAATGTTCTGTTTATCTGGAGGAATGCGCCAGCTGTGGTTATAGGAAGGCACCAAAATCCTTGGCGAGAATGCAATCTTCCTTTAATGAGAGAGAGGGGCATCTGTTTAGCAAGAAGACGCAGTGGAGGTGGAACTGTGTATCATGATCTTGGCAACATAAACTTAACATTTTTCACATCAAGGAAAAGATATGATAGAATGAAAAACTTAGAGTTAGTTATCAGGGCACTTAAAGCTCTGCAGCATCAAGTGGATGTCCAAGCAACCAGTAGATTTGATCTGCTCTTAGATAAGAAGTTTAAAATATCAGGGACAGCAGCAAAACTGGGAAGGACTGTTGCTTACCACCACTGTACTTTACTGTGTTCTGCAAATAGTTCTCTCCTACCAATTGTGTTGCAAAGCCCTTACCATGGTATAGAAAGTAATGCTACTCCTAGTGTGCCTTCACTGGTAAAAAATCTGTCTGACGCAGATTCTTCATTGAACTGTGAATCCCTCAAGGATGTGGTAGCATCTGAATACTCTGCACATTACAATAATAACCCTCATGGTTACTTAATAAAACCCAAGGGATGAATCACTTCTTTCCGGGGGATTAATCCAAAAAAAAAAGGGAAACTGGTGCACCTTTGGG
Full Trace Sequence: CGCGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCATCAGGCCAATGATCAGAAGTTTCCATTCCTTGTTTGCTTTACGCATCATACCAGCCAGATATGAAAGTTCTGTAAAAGAAGGTGTCATTTTGCAATCTACATCGAACAACGTTTATGAAAACTTAGCTATTGAAGACTGGATTCATGATCAAATGAACCTAGAAAACAAGAATGTTCTGTTTATCTGGAGGAATGCGCCAGCTGTGGTTATAGGAAGGCACCAAAATCCTTGGCGAGAATGCAATCTTCCTTTAATGAGAGAGAGGGGCATCTGTTTAGCAAGAAGACGCAGTGGAGGTGGAACTGTGTATCATGATCTTGGCAACATAAACTTAACATTTTTCACATCAAGGAAAAGATATGATAGAATGAAAAACTTAGAGTTAGTTATCAGGGCACTTAAAGCTCTGCAGCATCAAGTGGATGTCCAAGCAACCAGTAGATTTGATCTGCTCTTAGATAAGAAGTTTAAAATATCAGGGACAGCAGCAAAACTGGGAAGGACTGTTGCTTACCACCACTGTACTTTACTGTGTTCTGCAAATAGTTCTCTCCTACCAATTGTGTTGCAAAGCCCTTACCATGGTATAGAAAGTAATGCTACTCCTAGTGTGCCTTCACTGGTAAAAAATCTGTCTGACGCAGATTCTTCATTGAACTGTGAATCCCTCAAGGATGTGGTAGCATCTGAATACTCTGCACATTACAATAATAACCCTCATGGTTACTTAATAAAACCCAAGGGATGAATCACTTCTTTCCGGGGGATTAATCCAAAAAAAAAAGGGAAACTGGTGCACCTTTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCATCAGGCCAATGATCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839611
dbEST ID: 79657313
Trimmed Sequence: TCTTGAGGATAGGTCCTTAACAAGGTACTTAATAAAAAAAGCTGTTTCAGTAGGACAAAATTTACAGCCCACCAAGGCACTTTGCAGATCATTAGAGAGGTCTTTGGAGAGCCAGTAGTTAGGGAACTCTAGGGAACATTCCTCTATATATCCATTTTTTATTTGCATACTTAGTTTGATATCAACTATGGAATTTCTGTACAATATCTGAAATGTTGTTTTAAGCGAAAATTTTGGAGTTTTTCCATAAATCCAATCCCAAGTGCACAGATCCCTTTTTTTCTGACTAATCCCAGGAAAGAGTGATTCATCCTTTGGGTCTATTAAGTGAACATGAGGCTTATTATTGTAATGTGCAGAGTATTCAGATGCTACCACATCCATGATGGATTCACAGTTCAATGAAGAATCTGCGTCAGACAGATTTTTTACCAGTGAAGGCACACTAGGAGTAGCATTACTTTCTATACCATGGTAAGGGCTTTGCAACACAATTGGTAGGAGAGAACTATTTGCAGAACACAGTANAGTACAGTGGTGGTAAGCAACAGTCCTTCCCAGTTTTGCTGCTGTCCCTGATATTTTAAACTTCTTATCTNAGAGCAGATCAAATCTACTGGTTGCTTGGACATCCACTTGATGCTGCAGAGCTTTAAATGCCCTGATAACTAAACTCTAATTTTTCATTCTATCATATCCTTTTCCTTGATGTGAAAAATGGTTAGGTTTATGTTTGGCAAAAATCATGGATTCACAACTTTCCCCCCTTCCCCT
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTTGAGGATAGGTCCTTAACAAGGTACTTAATAAAAAAAGCTGTTTCAGTAGGACAAAATTTACAGCCCACCAAGGCACTTTGCAGATCATTAGAGAGGTCTTTGGAGAGCCAGTAGTTAGGGAACTCTAGGGAACATTCCTCTATATATCCATTTTTTATTTGCATACTTAGTTTGATATCAACTATGGAATTTCTGTACAATATCTGAAATGTTGTTTTAAGCGAAAATTTTGGAGTTTTTCCATAAATCCAATCCCAAGTGCACAGATCCCTTTTTTTCTGACTAATCCCAGGAAAGAGTGATTCATCCTTTGGGTCTATTAAGTGAACATGAGGCTTATTATTGTAATGTGCAGAGTATTCAGATGCTACCACATCCATGATGGATTCACAGTTCAATGAAGAATCTGCGTCAGACAGATTTTTTACCAGTGAAGGCACACTAGGAGTAGCATTACTTTCTATACCATGGTAAGGGCTTTGCAACACAATTGGTAGGAGAGAACTATTTGCAGAACACAGTANAGTACAGTGGTGGTAAGCAACAGTCCTTCCCAGTTTTGCTGCTGTCCCTGATATTTTAAACTTCTTATCTNAGAGCAGATCAAATCTACTGGTTGCTTGGACATCCACTTGATGCTGCAGAGCTTTAAATGCCCTGATAACTAAACTCTAATTTTTCATTCTATCATATCCTTTTCCTTGATGTGAAAAATGGTTAGGTTTATGTTTGGCAAAAATCATGGATTCACAACTTTCCCCCCTTCCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTGAGGATAGGTCCTTAAC