ORFeome > lmbrd2 ORF1 – XORFeome v1.0

lmbrd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lmbrd2
Gene ID: 991218
Gene Page ID: 991214
ORF Xenbase ID: 17282253

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043881
Original XGC clone length: 2142

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ823935
dbEST ID: 79641637
Trimmed Sequence: ATGAGTGGCGTAGCGCTTGGAATTGAGATAGTCTCCGTGTTTTTTCTGGCTCTCTTCCTTCTGCACCGATATGGAGACTTTAAAAAGCAGCACAAACTTGTCATTGTGGGCACTCTGTTAGCCTGGTATCTGTGTTTCCTTATCGTCTTTATTATACCTCTGGATGTCAGTACGACGATATACAACCGATGCGTTGCAAGACATGCTGTGACTCCTGCACCCAGCAACATAACTGTACTTAGCCCCACTCCTGGGATTGTATCGAATACCACCGCTCAAAACCATCTGCCTAGTGCTGACAAACTAAGGAGCAGCGACAATTCACTGGAGGAGTGTTCCAAGCCATGGAGCTACATTCCCAGGGGAATCATGCCAATCTTCTGGCGTGTTGTTTATTGGACATCACAATTTCTTACTTGGATTCTCATGCCGTTCATGCAATCCTACGCTCGCTCTGGAGGCTTTTCCATTACAGGAAAGATTAAAACAGCTCTGATTGAAAATGCGATTTATTATGGCACCTACTTGTTAATCTTTGGAGCGCTATTAATATATGTTGCTGTCAACCCTAATTTACATCTGGAATGGTACCAACTGCAAACCATTGGGATAGCTGCAGCCACACTTNGGGGTCTGTTCCTCCTTGNTTCTCTGATGGGGATACGGTTTTGGTAGAAATTCCTCGCTCCCNATGGAATGGAGCAAAAGAAGGGCTACTTACTGATGGAAAACTACTTTCAGGGCAGCTAAGTCCTTGACTGGAAAAGGCGAACGCCAGAAAAACTTTAAAGAAGGTTTTGGGAGGGAATTTCCCAAAACAAATGAAAGGATATAAATAAACCCCCCTC
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGGCGTAGCGCTTGGAATTGAGATAGTCTCCGTGTTTTTTCTGGCTCTCTTCCTTCTGCACCGATATGGAGACTTTAAAAAGCAGCACAAACTTGTCATTGTGGGCACTCTGTTAGCCTGGTATCTGTGTTTCCTTATCGTCTTTATTATACCTCTGGATGTCAGTACGACGATATACAACCGATGCGTTGCAAGACATGCTGTGACTCCTGCACCCAGCAACATAACTGTACTTAGCCCCACTCCTGGGATTGTATCGAATACCACCGCTCAAAACCATCTGCCTAGTGCTGACAAACTAAGGAGCAGCGACAATTCACTGGAGGAGTGTTCCAAGCCATGGAGCTACATTCCCAGGGGAATCATGCCAATCTTCTGGCGTGTTGTTTATTGGACATCACAATTTCTTACTTGGATTCTCATGCCGTTCATGCAATCCTACGCTCGCTCTGGAGGCTTTTCCATTACAGGAAAGATTAAAACAGCTCTGATTGAAAATGCGATTTATTATGGCACCTACTTGTTAATCTTTGGAGCGCTATTAATATATGTTGCTGTCAACCCTAATTTACATCTGGAATGGTACCAACTGCAAACCATTGGGATAGCTGCAGCCACACTTNGGGGTCTGTTCCTCCTTGNTTCTCTGATGGGGATACGGTTTTGGTAGAAATTCCTCGCTCCCNATGGAATGGAGCAAAAGAAGGGCTACTTACTGATGGAAAACTACTTTCAGGGCAGCTAAGTCCTTGACTGGAAAAGGCGAACGCCAGAAAAACTTTAAAGAAGGTTTTGGGAGGGAATTTCCCAAAACAAATGAAAGGATATAAATAAACCCCCCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGGCGTAGCGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829244
dbEST ID: 79646946
Trimmed Sequence: TACGTCGTCAAAAATTCTGCTGTTCGATTGAGACATGGATAAATACCGTCCTCCAGGTTGGTATCTTCCTGATTCTGAATCAAGTGGATCATCATTAAAGGTATCAGCATTGAAATCCAAGGGTTCTGCATCCTGCAGCAGTTCTATTCGATCTCTTTCCGTTCTGTTGCTAGCTCGGGTGTATTTGGATGATCTGTTTGTGGTCATTTCAGTGTAAGTAGGCTCTTTCTGGTCTGAATTCACGCTTCGGTTCCGGCTGGTGTCTTCTCTATTAGTAGGATAGCGCTCTTTCCACTCCCTCCTGCGTGTTTCACCGTCTTCTAGTCTCTGTCGCTTCCTTTTCTCTCTTTTAATTAACTCCTTCCCTTCGTCGGTTAGGTCTGACGTCATGTCATTGTCACCCATGAACTGCTGAAACCCAAGTAAGTTCAAACAACGAGTTCCCAGACTGAAATATGTTGCAATGCAGAGAATCAGAACCAGCATGGGGTAGTATATATAAAATACATCAGCAATAAGAGGCAAAACTCTTAAAGATCCCATTATAGATGTGTATGCGGTTGGCTCAATATTCTGGTGAGAGATTGATACGTCTATGTGAGTCAGTCCCAAGAAGTTCAAACATAAAGGAGGAGTCAAACGGCAGACCAGCATGCCGCTGAACAGAAAGCGGTAGGCATCAGTTTTGGTGATGAGATGCTAAATAAAAAATAGTTAAACCAA
Full Trace Sequence: TGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACGTCGTCAAAAATTCTGCTGTTCGATTGAGACATGGATAAATACCGTCCTCCAGGTTGGTATCTTCCTGATTCTGAATCAAGTGGATCATCATTAAAGGTATCAGCATTGAAATCCAAGGGTTCTGCATCCTGCAGCAGTTCTATTCGATCTCTTTCCGTTCTGTTGCTAGCTCGGGTGTATTTGGATGATCTGTTTGTGGTCATTTCAGTGTAAGTAGGCTCTTTCTGGTCTGAATTCACGCTTCGGTTCCGGCTGGTGTCTTCTCTATTAGTAGGATAGCGCTCTTTCCACTCCCTCCTGCGTGTTTCACCGTCTTCTAGTCTCTGTCGCTTCCTTTTCTCTCTTTTAATTAACTCCTTCCCTTCGTCGGTTAGGTCTGACGTCATGTCATTGTCACCCATGAACTGCTGAAACCCAAGTAAGTTCAAACAACGAGTTCCCAGACTGAAATATGTTGCAATGCAGAGAATCAGAACCAGCATGGGGTAGTATATATAAAATACATCAGCAATAAGAGGCAAAACTCTTAAAGATCCCATTATAGATGTGTATGCGGTTGGCTCAATATTCTGGTGAGAGATTGATACGTCTATGTGAGTCAGTCCCAAGAAGTTCAAACATAAAGGAGGAGTCAAACGGCAGACCAGCATGCCGCTGAACAGAAAGCGGTAGGCATCAGTTTTGGTGATGAGATGCTAAATAAAAAATAGTTAAACCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACGTCGTCAAAAATTCTGCTGTT