ORFeome > lmnb2 ORF1 – XORFeome v1.0

lmnb2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lmnb2
Gene ID: 6254662
Gene Page ID: 490442
ORF Xenbase ID: 17282271

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC073219
Original XGC clone length: 1875

Human orthology & disease relationships

NCBI Entrez ID: 84823
Ensembl gene IDs: ENSG00000176619
Directly associated (OMIM) disease MIM numbers: 608709
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11038
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ827302
dbEST ID: 79645004
Trimmed Sequence: ATGGCTACTGCTACACCAAGTCGGTCGGCGGCCTCATCCATGCAATCTCCTGCCCGGGGAATATCATCTACCCCTCTTTCACCAACTCGCATATCTAGGCTTCAGGAGAAGGAGGAGTTGAGACATCTCAATGACCGACTAGCCGTCTATATAGACCGCGTGCGTGCACTGGAGCTGGAAAATGACCGGCTGATGGTTAAGATTTCTGAAAAAGAGGAGGTTACCACTCGGGAGGTTAGTGGCATCAAGAACCTGTATGAATCAGAGCTTGCTGATGCGCGGAAGGTTTTGGATGAGACAGCCAGAGAGAGAGCACGGTTGCAAATAGAACTGGGAAAATTTCGTTCAGATCTTGACGAGCTAACAAAAAACTACAAAAAAAAAGATGCTGACCTGTCCACGGCACAGGGGCGTATTAAAGACTTGGAAGCTCTCTTTCACCGTAGTGAAGCAGAACTTGGAACTGCACTGGATGAGAAGCGTAGTTTGGAGGCAGAGGTAGCAGATCTTCGTGCCCAGCTCTCCAAGGCTGAAGATGCCCATGCTGTTGCTAAAAAACAGCTGGAAAAGGAGACCCTGATGAGAATTGACTTTGAAAATCGCATCCAGAGTTTGCAGGAGGAGATGGACTTCAGAAAGAATATTTAATGAGGAGGAGTCCCGTGAAAACAGGAAATCGTCATGAACGGCGATAAAATAAAAAGTGGAACAGGGGGTCATCACTTATGATTAATGAAATCCAAAATTGGGCACCAAGCCAATTAGAAATA
Full Trace Sequence: GGGGGGATGGGCTGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACTGCTACACCAAGTCGGTCGGCGGCCTCATCCATGCAATCTCCTGCCCGGGGAATATCATCTACCCCTCTTTCACCAACTCGCATATCTAGGCTTCAGGAGAAGGAGGAGTTGAGACATCTCAATGACCGACTAGCCGTCTATATAGACCGCGTGCGTGCACTGGAGCTGGAAAATGACCGGCTGATGGTTAAGATTTCTGAAAAAGAGGAGGTTACCACTCGGGAGGTTAGTGGCATCAAGAACCTGTATGAATCAGAGCTTGCTGATGCGCGGAAGGTTTTGGATGAGACAGCCAGAGAGAGAGCACGGTTGCAAATAGAACTGGGAAAATTTCGTTCAGATCTTGACGAGCTAACAAAAAACTACAAAAAAAAAGATGCTGACCTGTCCACGGCACAGGGGCGTATTAAAGACTTGGAAGCTCTCTTTCACCGTAGTGAAGCAGAACTTGGAACTGCACTGGATGAGAAGCGTAGTTTGGAGGCAGAGGTAGCAGATCTTCGTGCCCAGCTCTCCAAGGCTGAAGATGCCCATGCTGTTGCTAAAAAACAGCTGGAAAAGGAGACCCTGATGAGAATTGACTTTGAAAATCGCATCCAGAGTTTGCAGGAGGAGATGGACTTCAGAAAGAATATTTAATGAGGAGGAGTCCCGTGAAAACAGGAAATCGTCATGAACGGCGATAAAATAAAAAGTGGAACAGGGGGTCATCACTTATGATTAATGAAATCCAAAATTGGGCACCAAGCCAATTAGAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACTGCTACACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ827301
dbEST ID: 79645003
Trimmed Sequence: CATGACAGAGCAGCCTCTGGATGTTGTTCTTGGATCACCCTGCTGGTGAAAGAGATCTTCCTCACCAAAGTCTGCTTCTTCATCCTTTTCCTCCTCTACATTTCTTAAGACAGACTTTGTAACTGTTCTCACAGCTACTTCCTCCTCTTCGGTGTTAACCAGGTATGTTCTAATGTTGCAGCCTGTGCCCCAGGAACTCTGGTTCTTCCACACTAAAATGGAAGGGGGGCTGTGAGCCACACCAGCATCAGCACTGTAGATTTTTACAGACTGGCCTGCTTTTAGTACATATTTAGGGGTGAATTTGTAAACAATTTCCTCTTCCTCTCCAATTTTTCTTTTCAGCCTCCAGTTACCAAGGGACTGGTCCTTATCTGAGTTATTTTTAAGGTGGACATATTTTCCTTCCAAATCGATCTCCTCAATACTGATGCTTCCTGTGGCCGAAGCCTGCTGGGACAAGTGAAACTGAGTACCACTAATCTGCCCACTACTAACAGTGCGGCTAGAGCCTTCACTAGCAGTGATGTGACTTGAACCGAGGGAAATGCCAGTGCGCAAGCCTGTACTTGCCCCACCTTCCTCATATTCCTCTTCAATGCGCTTTCTTTTTGCTCTAAAGGTACGGGGTGGCAGAAGCACTACTGGAAAATAACCGTGGAAGACAGGACCCCTGAATTGCCGGGCTTTGGGGAAAGGCTTTAAACCTTTTCCCCTTCCTCCTTCCAACCTCCCTCCCCGGTAAACCATTTATATCCACAAATTAAAATTTAAAAT
Full Trace Sequence: GAAACGACTATTGACCATGTAATACGACTCACTATAGGGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGACAGAGCAGCCTCTGGATGTTGTTCTTGGATCACCCTGCTGGTGAAAGAGATCTTCCTCACCAAAGTCTGCTTCTTCATCCTTTTCCTCCTCTACATTTCTTAAGACAGACTTTGTAACTGTTCTCACAGCTACTTCCTCCTCTTCGGTGTTAACCAGGTATGTTCTAATGTTGCAGCCTGTGCCCCAGGAACTCTGGTTCTTCCACACTAAAATGGAAGGGGGGCTGTGAGCCACACCAGCATCAGCACTGTAGATTTTTACAGACTGGCCTGCTTTTAGTACATATTTAGGGGTGAATTTGTAAACAATTTCCTCTTCCTCTCCAATTTTTCTTTTCAGCCTCCAGTTACCAAGGGACTGGTCCTTATCTGAGTTATTTTTAAGGTGGACATATTTTCCTTCCAAATCGATCTCCTCAATACTGATGCTTCCTGTGGCCGAAGCCTGCTGGGACAAGTGAAACTGAGTACCACTAATCTGCCCACTACTAACAGTGCGGCTAGAGCCTTCACTAGCAGTGATGTGACTTGAACCGAGGGAAATGCCAGTGCGCAAGCCTGTACTTGCCCCACCTTCCTCATATTCCTCTTCAATGCGCTTTCTTTTTGCTCTAAAGGTACGGGGTGGCAGAAGCACTACTGGAAAATAACCGTGGAAGACAGGACCCCTGAATTGCCGGGCTTTGGGGAAAGGCTTTAAACCTTTTCCCCTTCCTCCTTCCAACCTCCCTCCCCGGTAAACCATTTATATCCACAAATTAAAATTTAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGACAGAGCAGCCTCTGGAT