ORFeome > lmo4.2 ORF1 – XORFeome v1.0

lmo4.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lmo4.2
Gene ID: 865262
Gene Page ID: 479326
ORF Xenbase ID: 17282295

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108585
Original XGC clone length: 516

Human orthology & disease relationships

NCBI Entrez ID: 8543
Ensembl gene IDs: ENSG00000143013
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,142680,151623,172800,180849,209950,219050,227650,600802,606764,606843,608089

Library Location

Plate ID: GDExl11087
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ837992
dbEST ID: 79655694
Trimmed Sequence: ATGGTGAATAACCGGAGCTCCGAGTCTACCACCACGGCGGTGAGCAGTAATGGCAGCCCACCCAAAGCTTGTGCCGGGTGCGGAGGGAAGATTGGCGACCGCTTCTTGCTCTATTCTATGGACAGGTACTGGCACACTCGCTGCCTGAAATGCTCCTGCTGCCAGGCACAACTGGGTGAGATTGGCACCTCCTGTTACACAAAGAGCGGCATGATCCTGTGCCGGAACGACTACATCCGGTTGTTTGGGAACAGTGGCGCTTGCAATGCATGTGGCCAGTCCATTCCTGCCAGTGAAATGGTCATGCGGGCACAAGGCAGTGTTTACCATCTGAAGTGTTTCACATGCGCCACGTGCAGGAACAGACTGGTACCCGGCGACAGGTTTCACTACGTCAATGGCACCATCTTCTGCGAACACGACCGTCCCACGGGGCTACTGAACGGCCACTTGAATCCCCTCCAGAGTAACCCACTCCAAGGCAGCCCCATGCTCCCTGACCAGAAAGTTTGCTT
Full Trace Sequence: GCTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAATAACCGGAGCTCCGAGTCTACCACCACGGCGGTGAGCAGTAATGGCAGCCCACCCAAAGCTTGTGCCGGGTGCGGAGGGAAGATTGGCGACCGCTTCTTGCTCTATTCTATGGACAGGTACTGGCACACTCGCTGCCTGAAATGCTCCTGCTGCCAGGCACAACTGGGTGAGATTGGCACCTCCTGTTACACAAAGAGCGGCATGATCCTGTGCCGGAACGACTACATCCGGTTGTTTGGGAACAGTGGCGCTTGCAATGCATGTGGCCAGTCCATTCCTGCCAGTGAAATGGTCATGCGGGCACAAGGCAGTGTTTACCATCTGAAGTGTTTCACATGCGCCACGTGCAGGAACAGACTGGTACCCGGCGACAGGTTTCACTACGTCAATGGCACCATCTTCTGCGAACACGACCGTCCCACGGGGCTACTGAACGGCCACTTGAATCCCCTCCAGAGTAACCCACTCCAAGGCAGCCCCATGCTCCCTGACCAGAAAGTTTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCACTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCTCCTATAGTGAGTCCTATTACATGGTAAAAAAAAAAAAAAAAAAAAAATCTAGTCCGGGTTCTCGAATACTCCGGGGGTAAAATGAACAAAAATCCCTGTTTCCCAAGGTGGGGCGGGGGGTTGTTTTCTTGGTTGGTGGTGGAGAGGAGAGGACCCCGGGGGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAATAACCGGAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837991
dbEST ID: 79655693
Trimmed Sequence: GCAAACTTTCTGGTCAGGGAGCATGGGGCTGCCTTGGAGTGGGTTACTCTGGAGGGGATTCAAGTGGCCGTTCAGTAGCCCCGTGGGACGGTCGTGTTCGCAGAAGATGGTGCCATTGACGTAGTGAAACCTGTCGCCGGGTACCAGTCTGTTCCTGCACGTGGCGCATGTGAAACACTTCAGATGGTAAACACTGCCTTGTGCCCGCATGACCATTTCACTGGCAGGAATGGACTGGCCACATGCATTGCAAGCGCCACTGTTCCCAAACAACCGGATGTAGTCGTTCCGGCACAGGATCATGCCGCTCTTTGTGTAACAGGAGGTGCCAATCTCACCCAGTTGTGCCTGGCAGCAGGAGCATTTCATGCAGCGAGTGTGCCAGTACCTGTCCATAGAATAGAGCAAGAACCGGTCCCCAATCTTCCCTCCGGACCCGGCACAAGCTTTGGGTGGGCTGCCGTTACTGCTCACCGCCGTGGTGGTAGACTCGGAACCGCGGTTATTCGCCATGGTGCCCACTTTTATGTACAGAGTTCGCCATTATACACAAACATTTCGCACCCAGTTTGTTTCAATCAAACGGGGGCACAGGGGGGGCGAAATTAAAAATCCAAAAAAAAAAAAAAAAAAGAGAAAAAAATTTACTTGGCCCTTTCGTGAAACGCCCGGGAACAAAAAAAGAACCCAAAAATCTCCTTCCCCCCAAAGGGGGGGCCGGGGGGGTTTCCCCCCGTGGTGGGTATAGGGAAGGGAAG
Full Trace Sequence: AAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAACTTTCTGGTCAGGGAGCATGGGGCTGCCTTGGAGTGGGTTACTCTGGAGGGGATTCAAGTGGCCGTTCAGTAGCCCCGTGGGACGGTCGTGTTCGCAGAAGATGGTGCCATTGACGTAGTGAAACCTGTCGCCGGGTACCAGTCTGTTCCTGCACGTGGCGCATGTGAAACACTTCAGATGGTAAACACTGCCTTGTGCCCGCATGACCATTTCACTGGCAGGAATGGACTGGCCACATGCATTGCAAGCGCCACTGTTCCCAAACAACCGGATGTAGTCGTTCCGGCACAGGATCATGCCGCTCTTTGTGTAACAGGAGGTGCCAATCTCACCCAGTTGTGCCTGGCAGCAGGAGCATTTCATGCAGCGAGTGTGCCAGTACCTGTCCATAGAATAGAGCAAGAACCGGTCCCCAATCTTCCCTCCGGACCCGGCACAAGCTTTGGGTGGGCTGCCGTTACTGCTCACCGCCGTGGTGGTAGACTCGGAACCGCGGTTATTCGCCATGGTGCCCACTTTTATGTACAGAGTTCGCCATTATACACAAACATTTCGCACCCAGTTTGTTTCAATCAAACGGGGGCACAGGGGGGGCGAAATTAAAAATCCAAAAAAAAAAAAAAAAAAGAGAAAAAAATTTACTTGGCCCTTTCGTGAAACGCCCGGGAACAAAAAAAGAACCCAAAAATCTCCTTCCCCCCAAAGGGGGGGCCGGGGGGGTTTCCCCCCGTGGTGGGTATAGGGAAGGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAACTTTCTGGTCAGG