ORFeome > LOC100036785 ORF1 – XORFeome v1.0

LOC100036785 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5772305
Gene Page ID: 5772270
ORF Xenbase ID: 17254275

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125994
Original XGC clone length: 1695

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ837289
dbEST ID: 79654991
Trimmed Sequence: ATGGCGGCTGCTGATCTGAGAGACGAGCTGAGCTGCTCCATCTGCCTGAGCATTTATACTGATCCTGTATCCCTGCCGTGGGCCCATAACTTCTGCCGGGGCTGTATTGGGAGGGTGCTGGGCACCCAGGAGGGATCTGGGCCTTATTCCTGCCCTGAATGCAGACAGGAGTTTAAGGAGCGCCCTGCCCTGCCCAGGAACAGAACTCTGGGGAACATAGCAGAGCGATTCCTTTCTGCTCAGCCCGAGCCGGGGGACACTGGGATTCCCTGCACCTACTGTGACTCCCATGTACCTGCTGTTAAATCCTGTCTCCTGTGTGAGGCTTCTCTGTGTAATAAGCACCTGAGGATGCACAGCAAGTCAGCGAAACACGTCTTAATAGAACCCACAATGGACATGGGGGACAAGAAATGCTCACTCCATGATGAACCCCTGAAATATTACTGCTGGGAGGAGTCTGTCTGTGTCTGTGTATATTGCTGGTTGTCTGAGGAGCACAAAAGCCACACGCCGCAGCTGCTGACTGAAGCCTCTGATAAGAAGAAGAAACACTCACGAAGAGTGGTGCGGGACTCCCGCCGGAGACAGAGGAGACTGGAAGAGAAGCGAAAAACTGCAAGGGGGGAGGAAATAGGGGGTCGGATGTTCAACCCGCGCGGCGAAGGAGTTCGCTCCCCGCTCGGGGGGGGGGGGGACAGACGGGGAGGGTGTATAAAACTAGTCCTCAACCCCAGTTGGGGGCGGGGGAGAGGAGGGGGGGGGAACACCTCTCCGTGACCGTGAGGGGGGGTGGGGGGGGGGGGGGGGG
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGCTGATCTGAGAGACGAGCTGAGCTGCTCCATCTGCCTGAGCATTTATACTGATCCTGTATCCCTGCCGTGGGCCCATAACTTCTGCCGGGGCTGTATTGGGAGGGTGCTGGGCACCCAGGAGGGATCTGGGCCTTATTCCTGCCCTGAATGCAGACAGGAGTTTAAGGAGCGCCCTGCCCTGCCCAGGAACAGAACTCTGGGGAACATAGCAGAGCGATTCCTTTCTGCTCAGCCCGAGCCGGGGGACACTGGGATTCCCTGCACCTACTGTGACTCCCATGTACCTGCTGTTAAATCCTGTCTCCTGTGTGAGGCTTCTCTGTGTAATAAGCACCTGAGGATGCACAGCAAGTCAGCGAAACACGTCTTAATAGAACCCACAATGGACATGGGGGACAAGAAATGCTCACTCCATGATGAACCCCTGAAATATTACTGCTGGGAGGAGTCTGTCTGTGTCTGTGTATATTGCTGGTTGTCTGAGGAGCACAAAAGCCACACGCCGCAGCTGCTGACTGAAGCCTCTGATAAGAAGAAGAAACACTCACGAAGAGTGGTGCGGGACTCCCGCCGGAGACAGAGGAGACTGGAAGAGAAGCGAAAAACTGCAAGGGGGGAGGAAATAGGGGGTCGGATGTTCAACCCGCGCGGCGAAGGAGTTCGCTCCCCGCTCGGGGGGGGGGGGGACAGACGGGGAGGGTGTATAAAACTAGTCCTCAACCCCAGTTGGGGGCGGGGGAGAGGAGGGGGGGGGAACACCTCTCCGTGACCGTGAGGGGGGGTGGGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGCTGATCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837288
dbEST ID: 79654990
Trimmed Sequence: TTTAATGATTCTCACCCAGGCACCATCACCATGATAGAATGCAGCATGAAGGGGCTCAGTGAATGTGACAGTGAAGGTGTGTAAGTGTCTGATTGGCTCACTCAGCTCATAAAAGGACAGACGTCCGGCCTCATGGTCCAATGAGATCCTGATTCTCCTGCAGGAAGGGACGTGGGGTAAATCTGTCTCTTTACTGTCATGTTCCACTGAATATCTGTTATTATTATTCCATCTGTACAAACACCAGGACTTGTTATTATTCCCAATCCAGGACTGATCCCCTCTCCTCTCTATACTGGGATAGGCCACCCCTACCATCCAGCCCCCTGATTCACTGACCTCCACTTCCCAGTAATGTCGCCCTGAGGGGAAACTCCTGCTGCTTAAAGCCTGAGCATATTCCTGAAATCTCTCTGGGGATTGTGGGTAATGTAGTTCTGTTAGTGAGTAGGAAGCAGATTTCCTGTCCCCTGATACAGATACACGATTATGAGCCCTGTTTATATCCAGTAACAGGTCTGTATCCTCCTGCCCATATACAGGGTCAAATCTACTGTTAGTAATAAAATTTAAATGGGAAATACTTGGTTTTGTTTTTATCCTTGAAACAAAAATTTCTGAACCCTTCTCCTCCCCTCCTTTATGGTACCGAAGAGAATGAGCGTGATTGTGGTAGTTACCCCCAGCCCCACCCGCAC
Full Trace Sequence: GGCACTAGGCTATGGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTAATGATTCTCACCCAGGCACCATCACCATGATAGAATGCAGCATGAAGGGGCTCAGTGAATGTGACAGTGAAGGTGTGTAAGTGTCTGATTGGCTCACTCAGCTCATAAAAGGACAGACGTCCGGCCTCATGGTCCAATGAGATCCTGATTCTCCTGCAGGAAGGGACGTGGGGTAAATCTGTCTCTTTACTGTCATGTTCCACTGAATATCTGTTATTATTATTCCATCTGTACAAACACCAGGACTTGTTATTATTCCCAATCCAGGACTGATCCCCTCTCCTCTCTATACTGGGATAGGCCACCCCTACCATCCAGCCCCCTGATTCACTGACCTCCACTTCCCAGTAATGTCGCCCTGAGGGGAAACTCCTGCTGCTTAAAGCCTGAGCATATTCCTGAAATCTCTCTGGGGATTGTGGGTAATGTAGTTCTGTTAGTGAGTAGGAAGCAGATTTCCTGTCCCCTGATACAGATACACGATTATGAGCCCTGTTTATATCCAGTAACAGGTCTGTATCCTCCTGCCCATATACAGGGTCAAATCTACTGTTAGTAATAAAATTTAAATGGGAAATACTTGGTTTTGTTTTTATCCTTGAAACAAAAATTTCTGAACCCTTCTCCTCCCCTCCTTTATGGTACCGAAGAGAATGAGCGTGATTGTGGTAGTTACCCCCAGCCCCACCCGCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTAATGATTCTCACCCAGGCAC