ORFeome > LOC100036796 ORF1 – XORFeome v1.0

LOC100036796 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5764010
Gene Page ID: 5764007
ORF Xenbase ID: 17254281

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127421
Original XGC clone length: 1716

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ837468
dbEST ID: 79655170
Trimmed Sequence: ATGACTGAACTGGATTTCATTTCAAGACGATCCCCCGTTGTGTGTACTGGTGGTTGTGTTGCATCAAGTCAGCCACTTGCAACAGATATTGGTTTAGATATTCTGAAAAATGGTGGAAATGCAGCTGATGCCGCAGTTGCTGTTGCTGCTGCCCTCAATATTACTGAACCCTGTAGCACTGGAATTGGTGGAGACTGCTTTTGTCTTTTTTACAGTGCAGAAACGAAACAGCTCCATGGACTCAATGGAAGTGGAAGATCTCCAATGGCGCTCAGCATTGATCTATTGAATGAAAAAGGGTTTAATGAGGATAATCCTGTCCCTGATACCCATGCTCTCAACATCACTGTCCCTGGGGCAGCAGCTGCTTGGGCTGACACTGTTTCTTTATTTGGAAGTAAAAAGCTGACATTGGGTGAGATTTTGAAGCCCGCAATTGAATTGGCTGAAAATGGCTTCCCGGTGTCTGAGATTTGTTCTTATGCTTGGGATAAAAGAGCCCATCTTCTTCAGAGTCCAACTAACCAGTATGGACAAGACTTGCTCATTGGTGGACAAGCTCCACAACATGCTCAACTTTTCAGATATCCATCATTGCCAAACGCGTTTAATGCTTTGTCTGAGACTGGAAAGAAAGGAATAAAAAAGAACCAGAATGGGGAAGGGATCGGCCCAACTCTCAAGAAAAAATGAAAGGGTTATTGGACCGAAATGACTGTGGCTACCGGGGGGGGAAAGGAGCGCCAACAGAAATCAGACCCACCACCACGGGCATCCCCACGTGGAAGAAATATAACTAGCGTTTGCCCACAAGAGAAACCAAAAAAACC
Full Trace Sequence: CGAGGGCCCCAAATAATGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGAACTGGATTTCATTTCAAGACGATCCCCCGTTGTGTGTACTGGTGGTTGTGTTGCATCAAGTCAGCCACTTGCAACAGATATTGGTTTAGATATTCTGAAAAATGGTGGAAATGCAGCTGATGCCGCAGTTGCTGTTGCTGCTGCCCTCAATATTACTGAACCCTGTAGCACTGGAATTGGTGGAGACTGCTTTTGTCTTTTTTACAGTGCAGAAACGAAACAGCTCCATGGACTCAATGGAAGTGGAAGATCTCCAATGGCGCTCAGCATTGATCTATTGAATGAAAAAGGGTTTAATGAGGATAATCCTGTCCCTGATACCCATGCTCTCAACATCACTGTCCCTGGGGCAGCAGCTGCTTGGGCTGACACTGTTTCTTTATTTGGAAGTAAAAAGCTGACATTGGGTGAGATTTTGAAGCCCGCAATTGAATTGGCTGAAAATGGCTTCCCGGTGTCTGAGATTTGTTCTTATGCTTGGGATAAAAGAGCCCATCTTCTTCAGAGTCCAACTAACCAGTATGGACAAGACTTGCTCATTGGTGGACAAGCTCCACAACATGCTCAACTTTTCAGATATCCATCATTGCCAAACGCGTTTAATGCTTTGTCTGAGACTGGAAAGAAAGGAATAAAAAAGAACCAGAATGGGGAAGGGATCGGCCCAACTCTCAAGAAAAAATGAAAGGGTTATTGGACCGAAATGACTGTGGCTACCGGGGGGGGAAAGGAGCGCCAACAGAAATCAGACCCACCACCACGGGCATCCCCACGTGGAAGAAATATAACTAGCGTTTGCCCACAAGAGAAACCAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGAACTGGATTTCATTTCA

Sequences - 3ʹ (reverse) EST

Accession: JZ837467
dbEST ID: 79655169
Trimmed Sequence: TATTGAATTGTGTTTCTCCTTGTGTTTATTCATGCAGTACCCCATTGCACAGCCATCTGCTCTGGGATCTGATCCAGCCCACCACACTTTACTATCATTACTATGAATACGATTCGGTCTCCACCAGTCCCCTTTGGAAATGATTTGGCCACGTCCAAATAGCTTCCTATCATGGCTGCAAATCGGACAGTGGATATCATGGCCTCTTGCTTTCAGTTCATCTGCTGCCATCTTGAAAATCCCATCCTCAAGGTAGAGCTGCCATTTCTGGTCTTGTTTGGAGTATTCTACGTAAAAGCGAGGCGCATCAAGAGCTTGCTGAGGATTCATCCCAAATTCTGCCATATTTAAAAGAACCTGTACATGTCCCTGAGGTTGCATAAATCCTCCCATCACACCAAATGAACACAACAGGTCCTGCGTATCTGCAGTTGTAGCCATAGCCGGGATGATGGTATGAAAGGGTCGTTTGCCAGGTGCTAAGCAGTTTGGGTCGCCCTTTGACAGTGAAAAGTTTTTCCCTCGGTTTTGTAAAGTAAAGCCACAAGCCTCACGCACTAGTCCCGTGCCAAAATCTTGATAATTACTGTTTATAAAAGAACAAGCATTTGCCTTGGGGGATCTACCACAAAACAATAAACGGTGTCACTCCCCAGTTTCATAAAGGTTTTCCTTGGGGTATTTATCCTCCAATTGCTCCTCTTGCAAATCAATAAACCTTTTCTCACCTCCTTTTCACCAAAAGG
Full Trace Sequence: AAAACTGCTAATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTGAATTGTGTTTCTCCTTGTGTTTATTCATGCAGTACCCCATTGCACAGCCATCTGCTCTGGGATCTGATCCAGCCCACCACACTTTACTATCATTACTATGAATACGATTCGGTCTCCACCAGTCCCCTTTGGAAATGATTTGGCCACGTCCAAATAGCTTCCTATCATGGCTGCAAATCGGACAGTGGATATCATGGCCTCTTGCTTTCAGTTCATCTGCTGCCATCTTGAAAATCCCATCCTCAAGGTAGAGCTGCCATTTCTGGTCTTGTTTGGAGTATTCTACGTAAAAGCGAGGCGCATCAAGAGCTTGCTGAGGATTCATCCCAAATTCTGCCATATTTAAAAGAACCTGTACATGTCCCTGAGGTTGCATAAATCCTCCCATCACACCAAATGAACACAACAGGTCCTGCGTATCTGCAGTTGTAGCCATAGCCGGGATGATGGTATGAAAGGGTCGTTTGCCAGGTGCTAAGCAGTTTGGGTCGCCCTTTGACAGTGAAAAGTTTTTCCCTCGGTTTTGTAAAGTAAAGCCACAAGCCTCACGCACTAGTCCCGTGCCAAAATCTTGATAATTACTGTTTATAAAAGAACAAGCATTTGCCTTGGGGGATCTACCACAAAACAATAAACGGTGTCACTCCCCAGTTTCATAAAGGTTTTCCTTGGGGTATTTATCCTCCAATTGCTCCTCTTGCAAATCAATAAACCTTTTCTCACCTCCTTTTCACCAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTGAATTGTGTTTCTCCTTGTG