ORFeome > LOC100036818 ORF1 – XORFeome v1.0

LOC100036818 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256173
Gene Page ID:
ORF Xenbase ID: 17254311

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128943
Original XGC clone length: 522

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ837864
dbEST ID: 79655566
Trimmed Sequence: ATGAACTCACAGGTGCGTCAGAACTACAGCCATGACTGCGAGGCAGCAGTGAACCGCATGGTGAACCTGGAACTGTATGCTTCCTACACCTACCAGTCCATGTCCTATTACTTTGACCGTGATGATGTGGCTCTTCACCACGTGGCCGAGCTTTTTAAGGAACACAGCAAAGAAGAGAGGGAATGTGCTGAGAAGCTGATGAAATGCCAGAATAAGCGTGGGGGTCGCATTGTCCTGCAGGATATTAAGAAACCAGAGAGAGATGAATGGGGAAGCACCCTGGATGCCATGCAAACAGCTTTGGATCTGGAGAAGCAGGTGAACCAGGCCTTATTGGAACTGCACAACCTGGCAACAGAAAGAAAGGACCCACACATCTGTGACTTCCTGGAGTCGGAACACCTTGATAAGCAAGTCAAGCACATGAAGAAATTCGGAGACTACATCACCAACCTGAAGCGTTTGGGGGTGCCCCAAAATGGCATGGGCGAGTACCTGTTTGACAAACACCGTGTGAGCTT
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTCACAGGTGCGTCAGAACTACAGCCATGACTGCGAGGCAGCAGTGAACCGCATGGTGAACCTGGAACTGTATGCTTCCTACACCTACCAGTCCATGTCCTATTACTTTGACCGTGATGATGTGGCTCTTCACCACGTGGCCGAGCTTTTTAAGGAACACAGCAAAGAAGAGAGGGAATGTGCTGAGAAGCTGATGAAATGCCAGAATAAGCGTGGGGGTCGCATTGTCCTGCAGGATATTAAGAAACCAGAGAGAGATGAATGGGGAAGCACCCTGGATGCCATGCAAACAGCTTTGGATCTGGAGAAGCAGGTGAACCAGGCCTTATTGGAACTGCACAACCTGGCAACAGAAAGAAAGGACCCACACATCTGTGACTTCCTGGAGTCGGAACACCTTGATAAGCAAGTCAAGCACATGAAGAAATTCGGAGACTACATCACCAACCTGAAGCGTTTGGGGGTGCCCCAAAATGGCATGGGCGAGTACCTGTTTGACAAACACCGTGTGAGCTTGCCAACTTTCTTGTACAAAATTGGCATTATAAAAAAGCATTGCTTTATCATTTGTTGCCGCGAACAGGTCACTATCATTCCAAATAAAATCATTATTTGCCTTCCAGCTGAAATCCCCTAAAGTGAATCCAAATAACATGGTCCTAAAAAAAAAAAAAAAACATTTTAAACCTTTCTCCCCAATTCTTTAAAACTTCAAAGGAAAAAAACCCCCACCTTTCTGCTCCCCCAGGGTTGGCGCGTGTTTTCTATTTCACTGTGAGGTTGGGAGGAGAACAGCGCACCCCCTATGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCACAGGTGCGTCAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837863
dbEST ID: 79655565
Trimmed Sequence: GCTCACACTGTGTTTGTCAAACAGGTACTCGCCCATGCCATTCTGGGGCACCCCCAAACGCTTCAGGTTGGTGATGTAGTCTCCGAATTTCTTCATGTGCTTGACTTGCTTATCAAGGTGTTCCGACTCCAGGAAGTCACAGATGTGTGGGTCCTTTCTTTCTGTTGCCAGGTTGTGCAGTTCCAATAAGGCCTGGTTCACCTGCTTCTCCAGATCCAAAGCTGTTTGCATGGCATCCAGGGTGCTTCCCCATTCATCTCTCTCTGGTTTCTTAATATCCTGCAGGACAATGCGACCCCCACGCTTATTCTGGCATTTCATCAGCTTCTCAGCACATTCCCTCTCTTCTTTGCTGTGTTCCTTAAAAAGCTCGGCCACGTGGTGAAGAGCCACATCATCACCGTCAAAGTAATAGGACATGCACTGGTAGGTGTATGAAACATACAGTTCCAGGTTCACCATGCGGTTCACTGCTGCCTCGCAGTCATGGCTGTAGTTCTGACACACCTGTGAATTCATGG
Full Trace Sequence: GGGCAGGGCAACAGCTTATGACCATGTAATACGACTCCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTCACACTGTGTTTGTCAAACAGGTACTCGCCCATGCCATTCTGGGGCACCCCCAAACGCTTCAGGTTGGTGATGTAGTCTCCGAATTTCTTCATGTGCTTGACTTGCTTATCAAGGTGTTCCGACTCCAGGAAGTCACAGATGTGTGGGTCCTTTCTTTCTGTTGCCAGGTTGTGCAGTTCCAATAAGGCCTGGTTCACCTGCTTCTCCAGATCCAAAGCTGTTTGCATGGCATCCAGGGTGCTTCCCCATTCATCTCTCTCTGGTTTCTTAATATCCTGCAGGACAATGCGACCCCCACGCTTATTCTGGCATTTCATCAGCTTCTCAGCACATTCCCTCTCTTCTTTGCTGTGTTCCTTAAAAAGCTCGGCCACGTGGTGAAGAGCCACATCATCACCGTCAAAGTAATAGGACATGCACTGGTAGGTGTATGAAACATACAGTTCCAGGTTCACCATGCGGTTCACTGCTGCCTCGCAGTCATGGCTGTAGTTCTGACACACCTGTGAATTCATGGTGCCAACTTTTTTGTACAAAATTGGCATTATGAAAAAGCATTGCTCAGCAATTTGTTACAACGAACAAATCAGTATGAGTCAAAATAAGATCGTTATTTTNNGAAAAAAAAAAAAAAAAAAAAAGGGTTTAATAACACGGGTCCTGGGGACGCCCGGGGCAGAAAACCCCGAATGCCTGCTCACCAAGGGTGCTGGTGGACCTCACCGGGGAAAAGAAAAAAAGGACAACACAAGGGAAAAAAACAGTGGGGGTGAGAAAACATAGTGGGAAAAGCGAAGAACAGCACCCAATGGGTCAAAAACATAGGGGAGGNGCGAGGGGTGAAGGGACAAGGGAGGNNAGGGGGAGAGGNNNGAGGAAGAANNGAAAAGNTAGGAGGNNGNGAGAAAAGAAAAGAAAAAAAAAGAGAAGAGGGAGGAGGNGNNGGNGGGGGGGGGANGNNGANNNAAGGGAGGNAGNAAAGAGNAGGAAGAGAGAAAGAGGGGNNNAGGANAGGGGGGAGGGNNNNGNGGGGNGNAGGGNAGNGGGGAAAGNGGGGNGAGGGGGGGGNNGGGAGGGGGGGNGGNAGAGNGGAGGANNGGGGGGGGNGGGAGGGAAAGNGAAGAGTGAGGGGACCGCNAGNGNGGGAAGGAGGGNNNGAGTGGGNGNGAGANNAGGGAGGGGGGGGGNAGGGGGGGANGGGGGGGGGGGANNNNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCACACTGTGTTTGTC