ORFeome > LOC100036837 ORF1 – XORFeome v1.0

LOC100036837 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5957156
Gene Page ID: 5957150
ORF Xenbase ID: 17254341

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129053
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ838312
dbEST ID: 79656014
Trimmed Sequence: ATGCCTCTTCCCACAACCAGTGGGAACCTTATTGTATATGATAAAGATTGTTCCTCAGTCTTTGAGAGTGGAAGGAAGGAGAGCGGCTATTATCGCGTGCGACCAAGGTTTGAGAATGAGCCCTTCCTAGTGTTCTGTGACATGTCTGATGGCGGTGGGTGGACAGTAATTCAACGCAGGAGCAATGGCAAAGTCAGCTTCAACCGGAATTGGGATGAGTATAAAGAAGGTTTTGGCCTTTTTAAAAGTCGAAATGATGAACACTGGATTGGGAACAATCACATATATGACCTGCTGGATAAAAGAGAAATGACACTGAAAATTGATCTGATGGACTGGCAAGGGAATGCAAAACATGCAATCTATGAGACCTTCAGGCTGACCAATGAGCAGGACAATTACCGGCTGTGGATAGGTTATTACTCTGGGAATGCAGGAGATGGTCTGTCTGGTGGAAGTAACTTTGATCAGCAGTGGTCGGCATCACTCAGTGGAATGCCATTCAGCACACCCGATATAGACAACGACAGGTTCATTAAGGGTAACTGCGCTAAGGAAAATAAATGTGGCTGGTGGTTCAACAGATGCCACGCTGCCAATTTAAATGGAGTGTACTATAAAAAGGGAAACTACACTGGAGTATATGATATTGGGTATTGTTTGGTCCACTTGGCATTGGATTTTGGTTCTCACTGAAATCCACCGCATTGAAAATAAGGAATCCATCGTTTCCTATTAAGGGAAATGGAAAGGGTTTTGGAATTCTTTTCCACCTTTCTTTTTTACAAGTTGGCATTTATAAAAAAAGCCTT
Full Trace Sequence: CGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCTTCCCACAACCAGTGGGAACCTTATTGTATATGATAAAGATTGTTCCTCAGTCTTTGAGAGTGGAAGGAAGGAGAGCGGCTATTATCGCGTGCGACCAAGGTTTGAGAATGAGCCCTTCCTAGTGTTCTGTGACATGTCTGATGGCGGTGGGTGGACAGTAATTCAACGCAGGAGCAATGGCAAAGTCAGCTTCAACCGGAATTGGGATGAGTATAAAGAAGGTTTTGGCCTTTTTAAAAGTCGAAATGATGAACACTGGATTGGGAACAATCACATATATGACCTGCTGGATAAAAGAGAAATGACACTGAAAATTGATCTGATGGACTGGCAAGGGAATGCAAAACATGCAATCTATGAGACCTTCAGGCTGACCAATGAGCAGGACAATTACCGGCTGTGGATAGGTTATTACTCTGGGAATGCAGGAGATGGTCTGTCTGGTGGAAGTAACTTTGATCAGCAGTGGTCGGCATCACTCAGTGGAATGCCATTCAGCACACCCGATATAGACAACGACAGGTTCATTAAGGGTAACTGCGCTAAGGAAAATAAATGTGGCTGGTGGTTCAACAGATGCCACGCTGCCAATTTAAATGGAGTGTACTATAAAAAGGGAAACTACACTGGAGTATATGATATTGGGTATTGTTTGGTCCACTTGGCATTGGATTTTGGTTCTCACTGAAATCCACCGCATTGAAAATAAGGAATCCATCGTTTCCTATTAAGGGAAATGGAAAGGGTTTTGGAATTCTTTTCCACCTTTCTTTTTTACAAGTTGGCATTTATAAAAAAAGCCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCTTCCCACAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ838311
dbEST ID: 79656013
Trimmed Sequence: GTAATCCAAACCCTGTCCACTTCCCTCACTGAGAAACGATGGACTCCTTATCTTCATTGCTGTAGATTTCAGTGAGTACCACAATCCATGCCAAGTTGACCAAACAATACCATTATCATATACTCCAGTGTAGTTTCCCTTTTTATAGTACACTCCATTTAAATTGGCAGCGTGGCATCTGTTGAACCACCAGCCACATTTATTTTCCTTAGCGCAGTTACCCTTAATGAACCTGTCGTTGTCTATATCGGGTGTGCTGAATGGCATTCCACTGAGTGATGCCGACCACTGCTGATCAAAGTTACTTCCACCAGACAGACCATCTCCTGCATTCCCAGAGTAATAACCTATCCACAGCCGGTAATTGTCCTGCTCATTGGTCAGCCTGAAGGTCTCATAGATTGCATGTTTTGCATTCCCTTGCCAGTCCATCAGATCAATTTTCAGTGTCATTTCTCTTTTATCCAGCAGGTCATATATGTGATTGTTCCCAATCCAGTGTTCATCATTTCGACTTTTAAAAAGCCAAAACCTTCTTTATACTCATCCCAATTCCGGTTGAAGCTGAATTTGCCATTGCTCCTGCTTTGAATACTGGCCACCCCCCCCCTTCAAACATGTCAAGAAAAATAGGGAAAGGCTCATTTCCCAAAACCTGGGTCCCACCCGATAATAACCCCCTCTCCCTTCCTTCAACTCTCAAAAAACTGAGGGAACAGGCTTTTGACAGAAACCAAATAAGGTTTCCCCCATTGGGGTTGT
Full Trace Sequence: GGAAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAATCCAAACCCTGTCCACTTCCCTCACTGAGAAACGATGGACTCCTTATCTTCATTGCTGTAGATTTCAGTGAGTACCACAATCCATGCCAAGTTGACCAAACAATACCATTATCATATACTCCAGTGTAGTTTCCCTTTTTATAGTACACTCCATTTAAATTGGCAGCGTGGCATCTGTTGAACCACCAGCCACATTTATTTTCCTTAGCGCAGTTACCCTTAATGAACCTGTCGTTGTCTATATCGGGTGTGCTGAATGGCATTCCACTGAGTGATGCCGACCACTGCTGATCAAAGTTACTTCCACCAGACAGACCATCTCCTGCATTCCCAGAGTAATAACCTATCCACAGCCGGTAATTGTCCTGCTCATTGGTCAGCCTGAAGGTCTCATAGATTGCATGTTTTGCATTCCCTTGCCAGTCCATCAGATCAATTTTCAGTGTCATTTCTCTTTTATCCAGCAGGTCATATATGTGATTGTTCCCAATCCAGTGTTCATCATTTCGACTTTTAAAAAGCCAAAACCTTCTTTATACTCATCCCAATTCCGGTTGAAGCTGAATTTGCCATTGCTCCTGCTTTGAATACTGGCCACCCCCCCCCTTCAAACATGTCAAGAAAAATAGGGAAAGGCTCATTTCCCAAAACCTGGGTCCCACCCGATAATAACCCCCTCTCCCTTCCTTCAACTCTCAAAAAACTGAGGGAACAGGCTTTTGACAGAAACCAAATAAGGTTTCCCCCATTGGGGTTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAATCCAAACCCTGTCCACT