ORFeome > LOC100036865 ORF1 – XORFeome v1.0

LOC100036865 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5721646
Gene Page ID: 5721641
ORF Xenbase ID: 17254377

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129557
Original XGC clone length: 1029

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ837842
dbEST ID: 79655544
Trimmed Sequence: ATGCAAGCAGAATTTCAGTATGGATTCTTTACAGTTATGTACAGCCTAGTGTTCATCCTGGGCTTGCCTGGGAATGCTTTCGCTCTCTATTACTTGAGCCAACGTAAACAGCGTTCCAGGAGCACGAATGTCTTTTTCCTGAACCTGTCTCTAGTTGACACTGTATTCATATGCCTCTTGCCCATTCGCATTTACTACCACAATACTGGAAATAACTGGGTGTTTGGAGATATTGCTTGTCGCATTACAGGTGGCCTCTTTTATGGCAACATCTATCTGAGCATCGGATTTTTCACTTGTATAAGCTTGGATAGGTACCTTGCTGTTGTGCACCCACTCACGTACAGAGGACGGAAGTTCAGACGTTACCCCTTGGTATTGACAATCCTTATCTGGATGATATGTGCTGCTATTGTCTTGCCATTGATACTCGGGGGACCACTTAACAACGTCTTGGAAACAAAGAACCGGACATCTTGCTTTGAGGAGTTCTCCCCAACGAGCTGGCATAATCGACTTGTTCCCTACAATGTATGTGCTTTGATCTTTGGCTTTTTAATCCTTTCACAGTTATAGCAGTTGTGTTTCCACTCAAGGCTCGGAAGATTTGCAAAAAAAGAAAAAACAACAACCGGCAAGTTGCCCTTAGGGAATTATTGGGTTAATCATTGGGAGTTTCTTTTCTTTTTGTTTTTTGCCTTTAAATAATGAGGC
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAAGCAGAATTTCAGTATGGATTCTTTACAGTTATGTACAGCCTAGTGTTCATCCTGGGCTTGCCTGGGAATGCTTTCGCTCTCTATTACTTGAGCCAACGTAAACAGCGTTCCAGGAGCACGAATGTCTTTTTCCTGAACCTGTCTCTAGTTGACACTGTATTCATATGCCTCTTGCCCATTCGCATTTACTACCACAATACTGGAAATAACTGGGTGTTTGGAGATATTGCTTGTCGCATTACAGGTGGCCTCTTTTATGGCAACATCTATCTGAGCATCGGATTTTTCACTTGTATAAGCTTGGATAGGTACCTTGCTGTTGTGCACCCACTCACGTACAGAGGACGGAAGTTCAGACGTTACCCCTTGGTATTGACAATCCTTATCTGGATGATATGTGCTGCTATTGTCTTGCCATTGATACTCGGGGGACCACTTAACAACGTCTTGGAAACAAAGAACCGGACATCTTGCTTTGAGGAGTTCTCCCCAACGAGCTGGCATAATCGACTTGTTCCCTACAATGTATGTGCTTTGATCTTTGGCTTTTTAATCCTTTCACAGTTATAGCAGTTGTGTTTCCACTCAAGGCTCGGAAGATTTGCAAAAAAAGAAAAAACAACAACCGGCAAGTTGCCCTTAGGGAATTATTGGGTTAATCATTGGGAGTTTCTTTTCTTTTTGTTTTTTGCCTTTAAATAATGAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAAGCAGAATTTCAGTATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837841
dbEST ID: 79655543
Trimmed Sequence: CAGTGCTGACCATTCAGCCTTGGCTACCAGAGTGATGTTTCCAGTCTCCTGTCGGCAGGCCAACACTGAACGTGGTTGAGAGATAGATAGGACGTTTGGCTTTGATGTTTTCTCTTTGCTAACTGTGTACACCTTCTTGGTGCGACTTGACCTTGGGAGTTTTAATGTTCGACTTAACGAAGGTATGAAGTACAAAAGTGGGTTGATGCAGCTGTTCAGACTGACCAGAGCCAATGTAATGCGACGTAGTTTGTAGATGATAACACTTGCAGAGCATTGCTCTATAAAGTGCAGTCTCATGAGAAAGTGAAAAAGGTGGGTGATATTATAAGGCAAAAAGCAAATGAGAGAAACTGCAATGATAAACCCAATAATCCTTAAGGCCACTGTCCGGTGGATGCTTTTTCTTATTCTGCAAATCTTCCGAGCCATGAGTGGAAACACAATTGCTATAACTGTGAGAGGGATGAAAAAGCCAAAGATCAGAGCACATACATTGTAGGGAACGAGTCGATTATGCCAGCTCCTTCCGGAGAACTCCTCAGAGCAAGATGTCCGGTTCTTTGTTTCCAAGACGTTGTTAGGAGGTCGGCCGACTAACACTGGCAAGACAATAGCTTCGACATAAATCCAGATAAGGAATGTCATTACCAGGGGGTGAGGTTGAACTTCCGTCCTCTGTCCGTGAGTGGGTGGAGAGCACCAAGGGACCTGTCGAATCTGATACTAAAAAAAAATCAAAGCCCCAAATAAATTTTGTCGTAACAGAACCCCCGTGAATGCCGACAAGCGGGACTCCAAACACGGAGTTTTTTCATTTTGGGGATAGAGGGGGCGAGGGGACAAAAGCCGAAAAAATAGATTATCATTTGGAAGAAGGTGAAGGGGAGAAAGATCCGAGTCCTCCCAGCCCGGGTTAGGGTTCGCGGGGTTATTGGGAAAGGAAAAACAAGCCCGGAGCGGCCCCGCGGAGGAAGCGGGGGGGGGGGGAAAGGGAGGAGAAGAAAAACAAAAAGTAAGAATACGGGAAGAAAGGCCGCTCGGCTGGTTGGTGGGGGGGTGAGGTTTGGAGAGATGGGGGGGGGGAAGGGAGGGGGGGGGGGCGGCGGGAGGAAGAGAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAGAAGAAAAAAAGAACAAACAAAGAAG
Full Trace Sequence: GGGCAGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTGCTGACCATTCAGCCTTGGCTACCAGAGTGATGTTTCCAGTCTCCTGTCGGCAGGCCAACACTGAACGTGGTTGAGAGATAGATAGGACGTTTGGCTTTGATGTTTTCTCTTTGCTAACTGTGTACACCTTCTTGGTGCGACTTGACCTTGGGAGTTTTAATGTTCGACTTAACGAAGGTATGAAGTACAAAAGTGGGTTGATGCAGCTGTTCAGACTGACCAGAGCCAATGTAATGCGACGTAGTTTGTAGATGATAACACTTGCAGAGCATTGCTCTATAAAGTGCAGTCTCATGAGAAAGTGAAAAAGGTGGGTGATATTATAAGGCAAAAAGCAAATGAGAGAAACTGCAATGATAAACCCAATAATCCTTAAGGCCACTGTCCGGTGGATGCTTTTTCTTATTCTGCAAATCTTCCGAGCCATGAGTGGAAACACAATTGCTATAACTGTGAGAGGGATGAAAAAGCCAAAGATCAGAGCACATACATTGTAGGGAACGAGTCGATTATGCCAGCTCCTTCCGGAGAACTCCTCAGAGCAAGATGTCCGGTTCTTTGTTTCCAAGACGTTGTTAGGAGGTCGGCCGACTAACACTGGCAAGACAATAGCTTCGACATAAATCCAGATAAGGAATGTCATTACCAGGGGGTGAGGTTGAACTTCCGTCCTCTGTCCGTGAGTGGGTGGAGAGCACCAAGGGACCTGTCGAATCTGATACTAAAAAAAAATCAAAGCCCCAAATAAATTTTGTCGTAACAGAACCCCCGTGAATGCCGACAAGCGGGACTCCAAACACGGAGTTTTTTCATTTTGGGGATAGAGGGGGCGAGGGGACAAAAGCCGAAAAAATAGATTATCATTTGGAAGAAGGTGAAGGGGAGAAAGATCCGAGTCCTCCCAGCCCGGGTTAGGGTTCGCGGGGTTATTGGGAAAGGAAAAACAAGCCCGGAGCGGCCCCGCGGAGGAAGCGGGGGGGGGGGGAAAGGGAGGAGAAGAAAAACAAAAAGTAAGAATACGGGAAGAAAGGCCGCTCGGCTGGTTGGTGGGGGGGTGAGGTTTGGAGAGATGGGGGGGGGGAAGGGAGGGGGGGGGGGCGGCGGGAGGAAGAGAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAGAAGAAAAAAAGAACAAACAAAGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTGCTGACCATTCAGCCTT