ORFeome > LOC100036870 ORF1 – XORFeome v1.0

LOC100036870 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5962687
Gene Page ID: 5962685
ORF Xenbase ID: 17254383

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129566
Original XGC clone length: 651

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ837888
dbEST ID: 79655590
Trimmed Sequence: ATGGCTCTAGTGAGAACAGGTCCAAGCCTTTGTGGAGGAACTTTGATTAAAGACAACTGGGTGTTGACAGCAGCTGCTTGTAAAGTTGACAAAACAACTACAGTTGATCTTGGTGTCCATTCAATAAAAACAATGAATAAACTGAGACAGCAGTTTAAGGTTGTACGATCGGCCCCACACCAGAAGTTTGATCAACGCTCATATGCCAATAACCTCCAACTATTACAGTTGTCTGGCAAAGCAAATTTTAGTTATGCTGTGAATGTTCTACCATTGCCATCGAAATATAAGGATATCAAGCCTGGGACTTTATGTCAAACAGCCGGATGGGGTATTACTGCCTATAATGGAAAGCAACGATCTGACAAACTGATGGAAGTCAGTTTAACTGTATTGGACAGAATGAAATGTAAAGACCAGTGGAAGTCGAAAATCAAAGTAACAAAAGACATGATATGCACCAGTGACAAAGGAAAAAGGGGCTTCTGTAATGGTGATAGTGGAGGACCTCTCATCTGCAACCGCATATTCACTGGTGTCGTTTCATTTGGACCCTTAATTTGTGGTATGGAAAATGGAGCCAATGTCTACACACGTCTAACTAATGATTACATTAAATGGATTAAAAAAAAAACTAAAAAACAAATATTGCCAACTTTCCTGTAACAAAATTGGGATTTTAAGAAAACAATTGCTTAACATTTTGTTTGCAAGCAAGCAAGGGCACCTAACAGTCCAAAAAAAAAACCATTAATTTTTCCAACCCAACCTGAAAAATCCCCCCAAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GGACCCCATATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTAGTGAGAACAGGTCCAAGCCTTTGTGGAGGAACTTTGATTAAAGACAACTGGGTGTTGACAGCAGCTGCTTGTAAAGTTGACAAAACAACTACAGTTGATCTTGGTGTCCATTCAATAAAAACAATGAATAAACTGAGACAGCAGTTTAAGGTTGTACGATCGGCCCCACACCAGAAGTTTGATCAACGCTCATATGCCAATAACCTCCAACTATTACAGTTGTCTGGCAAAGCAAATTTTAGTTATGCTGTGAATGTTCTACCATTGCCATCGAAATATAAGGATATCAAGCCTGGGACTTTATGTCAAACAGCCGGATGGGGTATTACTGCCTATAATGGAAAGCAACGATCTGACAAACTGATGGAAGTCAGTTTAACTGTATTGGACAGAATGAAATGTAAAGACCAGTGGAAGTCGAAAATCAAAGTAACAAAAGACATGATATGCACCAGTGACAAAGGAAAAAGGGGCTTCTGTAATGGTGATAGTGGAGGACCTCTCATCTGCAACCGCATATTCACTGGTGTCGTTTCATTTGGACCCTTAATTTGTGGTATGGAAAATGGAGCCAATGTCTACACACGTCTAACTAATGATTACATTAAATGGATTAAAAAAAAAACTAAAAAACAAATATTGCCAACTTTCCTGTAACAAAATTGGGATTTTAAGAAAACAATTGCTTAACATTTTGTTTGCAAGCAAGCAAGGGCACCTAACAGTCCAAAAAAAAAACCATTAATTTTTCCAACCCAACCTGAAAAATCCCCCCAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTAGTGAGAACAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837887
dbEST ID: 79655589
Trimmed Sequence: TATTCGTTTCTTAGTTTCTTTTTTAATCCATTTAATGTAATCACTAGTTAGACGTGTGTAGACATTGGCTCCATTTTCCATACCACAAATTAAGGGTCCAAATGAAACGACACCAGTGAATATGCGGTTGCAGATGAGAGGTCCTCCACTATCACCATTACAGAAGCCCCTTTTTCCTTTGTCACTGGTGCATATCATGTCTTTTGTTACTTTGATTTTCGACTTCCACTGGTCTTTACATTTCATTCTGTCCAATACAGTTAAACTGACTTCCATCAGTTTGTCAGATCGTTGCTTTCCATTATAGGCAGTAATACCCCATCCGGCTGTTTGACATAAAGTCCCAGGCTTGATATCCTTATATTTCGATGGCAATGGTAGAACATTCACAGCAGAACTAAAATTTGCTTTGCCAGACAACTGTAATAGTTGGAGGTTATTGTCATATGAGCGTTGATCAAACTTCTGGTGTGGGGCCGATCGTACAACCTTAAACTGCTGTCTCAATTTATTCATTGGTTTTATTGAATGGACACGAAGATCAACTGTAGTTGTTTTGGTCACTTTACAAGCAGCTGCTGTCAACACCCAGTTGTCTTTAATCGAAGTTCCTCCACAAAAGCCATGGACGTGTTCTCACTAAAACCAAGGGTGCCAGCTTTTTTTTACAAGGGGTGGCTTTTAAAAAAACGATGGCTCTCAAATTTTTGCAACAAACAAGTGAGTAGCGGTCGGGATAGAATCATTATAAAAAAGAAAGAAATAAAGGAAAAAATCGCTTCCATACGACATGACGGACAAAAAGGAAACAAATCCGTGCATCGAAGATTGGCGGTGAGGTATTCCGTAAGGGGGGGGAGGCGCACCCCGGAAAGAGAAACGGTTGGGGGGCAAGTGAAGAGAAGAAAACGAAGGCCCAGCGAGAGGGGCCGAACAATAACAAGAAAAAAAGAGAAAGAAAAAAAAAAAATATTATGGAATATTTTAAGCGGAAGAGGGGGGGGGAGGGGCACCGCTCGAGGAAAGAAGAGAAACAAAGGGTGGGGGAGGAGNGAGGGAGGGGAGGGGAGGGGGGGGGGGGGGAAGTAGAAATGTGGGNAGGGAGGAGGGGGGAGANAGGAGGGNGNGAAGGAAGGNGGAGAGAGAGGGGGAAAGGAGAGAGGNAGGAGAGGAGNNNNNNAGGGGGGAAGAGGGGACGNGGGGN
Full Trace Sequence: CGGGCAGGTAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTCGTTTCTTAGTTTCTTTTTTAATCCATTTAATGTAATCACTAGTTAGACGTGTGTAGACATTGGCTCCATTTTCCATACCACAAATTAAGGGTCCAAATGAAACGACACCAGTGAATATGCGGTTGCAGATGAGAGGTCCTCCACTATCACCATTACAGAAGCCCCTTTTTCCTTTGTCACTGGTGCATATCATGTCTTTTGTTACTTTGATTTTCGACTTCCACTGGTCTTTACATTTCATTCTGTCCAATACAGTTAAACTGACTTCCATCAGTTTGTCAGATCGTTGCTTTCCATTATAGGCAGTAATACCCCATCCGGCTGTTTGACATAAAGTCCCAGGCTTGATATCCTTATATTTCGATGGCAATGGTAGAACATTCACAGCAGAACTAAAATTTGCTTTGCCAGACAACTGTAATAGTTGGAGGTTATTGTCATATGAGCGTTGATCAAACTTCTGGTGTGGGGCCGATCGTACAACCTTAAACTGCTGTCTCAATTTATTCATTGGTTTTATTGAATGGACACGAAGATCAACTGTAGTTGTTTTGGTCACTTTACAAGCAGCTGCTGTCAACACCCAGTTGTCTTTAATCGAAGTTCCTCCACAAAAGCCATGGACGTGTTCTCACTAAAACCAAGGGTGCCAGCTTTTTTTTACAAGGGGTGGCTTTTAAAAAAACGATGGCTCTCAAATTTTTGCAACAAACAAGTGAGTAGCGGTCGGGATAGAATCATTATAAAAAAGAAAGAAATAAAGGAAAAAATCGCTTCCATACGACATGACGGACAAAAAGGAAACAAATCCGTGCATCGAAGATTGGCGGTGAGGTATTCCGTAAGGGGGGGGAGGCGCACCCCGGAAAGAGAAACGGTTGGGGGGCAAGTGAAGAGAAGAAAACGAAGGCCCAGCGAGAGGGGCCGAACAATAACAAGAAAAAAAGAGAAAGAAAAAAAAAAAATATTATGGAATATTTTAAGCGGAAGAGGGGGGGGGAGGGGCACCGCTCGAGGAAAGAAGAGAAACAAAGGGTGGGGGAGGAGNGAGGGAGGGGAGGGGAGGGGGGGGGGGGGGAAGTAGAAATGTGGGNAGGGAGGAGGGGGGAGANAGGAGGGNGNGAAGGAAGGNGGAGAGAGAGGGGGAAAGGAGAGAGGNAGGAGAGGAGNNNNNNAGGGGGGAAGAGGGGACGNGGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTCGTTTCTTAGTTTCTTTTTT