ORFeome > LOC100036877 ORF1 – XORFeome v1.0

LOC100036877 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256149
Gene Page ID:
ORF Xenbase ID: 17254401

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129580
Original XGC clone length: 1389

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ837821
dbEST ID: 79655523
Trimmed Sequence: ATGTCTGAGGGCAAGCAGCACGTGTCGATTGTCATCTGCGGCCATGTCGACGCCGGCAAGTCGACGACCACCGGCCGTCTGATCTTCGAGCTGGGAGGGATCCCCGAGCGTGAGATGCAGAAGCTCAAGGATGAGGCCCAGAAGCTCGGCAAGGGCTCGTTCGCCTTCGCCTTCTACATGGATCGCCAGAAGGACGAGCGTGAGCGTGGTGTGACCATCGCCTGCACCACCAAGGAGTTCTTCACCACCACCAAGCACTACACGGTCATCGACGCCCCGGGCCATCGCGATTTCATCAAGAACATGATCACGGGTGCCTCCCAGGCCGATGTCGCCCTTCTGATGATCCCCGCCGACGGTAACTTCACCGCCGCCATCGCCAAGGGCAACCACAAGGCCGGTGAGGTCCAGGGCCAGACCCGCCAGCACGCCCTGCTCATCAACCTGCTCGGCTGCAAGCAGCTCATCGTCGGCGTCAACAAGATGGACTGCGATGTCGCCGAGTACGGCAAGCCCCGCTACGATGAGATCAACGACGAGATGATGCATATGCTTACCCGCGTCGGCTGGGAGAAAGAATTTTGTCTTCAATTCGTGCCCGTCCTTCCCCCTCCTCTGCTGGGATGGGGACAGACTGCTGACGAAGTCCGCCCAACATGCCGGTGGTGGGGGGGGGGGGGGATGGCCTGCTTTCTGCCCCGGGAGAGAAATCAAAACTCTCCCCCCCATGTCCCCATTCCCCCCTGCCAAGAGAGAGGGGAAGAAGGTGTGGGGCTCGCCCGGGCCCTCGCGCCAG
Full Trace Sequence: TCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGAGGGCAAGCAGCACGTGTCGATTGTCATCTGCGGCCATGTCGACGCCGGCAAGTCGACGACCACCGGCCGTCTGATCTTCGAGCTGGGAGGGATCCCCGAGCGTGAGATGCAGAAGCTCAAGGATGAGGCCCAGAAGCTCGGCAAGGGCTCGTTCGCCTTCGCCTTCTACATGGATCGCCAGAAGGACGAGCGTGAGCGTGGTGTGACCATCGCCTGCACCACCAAGGAGTTCTTCACCACCACCAAGCACTACACGGTCATCGACGCCCCGGGCCATCGCGATTTCATCAAGAACATGATCACGGGTGCCTCCCAGGCCGATGTCGCCCTTCTGATGATCCCCGCCGACGGTAACTTCACCGCCGCCATCGCCAAGGGCAACCACAAGGCCGGTGAGGTCCAGGGCCAGACCCGCCAGCACGCCCTGCTCATCAACCTGCTCGGCTGCAAGCAGCTCATCGTCGGCGTCAACAAGATGGACTGCGATGTCGCCGAGTACGGCAAGCCCCGCTACGATGAGATCAACGACGAGATGATGCATATGCTTACCCGCGTCGGCTGGGAGAAAGAATTTTGTCTTCAATTCGTGCCCGTCCTTCCCCCTCCTCTGCTGGGATGGGGACAGACTGCTGACGAAGTCCGCCCAACATGCCGGTGGTGGGGGGGGGGGGGGATGGCCTGCTTTCTGCCCCGGGAGAGAAATCAAAACTCTCCCCCCCATGTCCCCATTCCCCCCTGCCAAGAGAGAGGGGAAGAAGGTGTGGGGCTCGCCCGGGCCCTCGCGCCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGAGGGCAAGCAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ837820
dbEST ID: 79655522
Trimmed Sequence: CAGGAACTCGACAGTCACGACCTTGCCCAGCATGACCACGGAGTTGCCCTCCATGAGCGCGACGCGGCCCAGACCCTCGCAGTTCTTGAACGAGTCGACGACGAAGGGCTGCATGGGCTCGAAGGTGCACTCGGCCATCTCGTTGGCCTTGATGCTCTGGGGGTTCTCCATCTTGGAGCCACCAGTCTCCTTGCCAACCTTCCAGGCGATCTTGGTCAGCTTGACGGCGGAGCGGCCCGTGCGGACGAAGGCGACCGGGCAGTAGCCGACCTTGAGCTCACCGGGGTGGTTCATGATCTGCACCTGGACGGTGAAGTTCTTGCAGCGGCCCAAGCTCTGGTCCGATTTTAAGATCATGACGTCACCAGTGCGCGGCATATTCTTGGCGTTCAAGTTCTTGACGTTCATGCCGACGTTGTCGCCAGGGCCGGCCGACTCGACCTGCTTGTGGTGCATCTCAACAGAGAACACCTTGCCGGTGCAGGCGGTGGAGGGGGTGTGGGTGGGCCGGAAGATGGCTGGAAAACGGACTTTGTCGGGGCCCTCGGTGCCACGGCCCCCTCCCCGGCGGGGACGCCGATAAACGTGAAACCGACTACAAAAGAAAGAAAGGGGGGGAGGGGGGGGAGGCGGGCGGGGGGCAGAAAAACTACCCATCGAGGGGCTGGAAAGTGGCTGGGAGAAAAAAGGGGCTTTTGGCGAAAAAACAGGAGACACCCCACACGGGAGGACTGGGGGGGGGGGTCGGAAAAAGGGGGGGAGGGAACGGGGGAAGGGGGGGGGGGAGGGAGGGGGGTAAGAACGGGTATAAATCCCCTCCGGGGGCGAGCACAAAAGCCCCGCCGTGGGGCGGGGAGGGGGGGGTGGGGGGGGGGGGAAACAACGGGGGGGGCGTCCGCGGGTGGGAAAAGAAACAAATAATGGGGCAGAAAAATTAAAAAAAGGGAAAAGAGCGCGGGGGGGGGGGGGGGGGGGGGTAGGAAGGGGAGGGGCACAAAGAGGGAGGGGGGGGGTGGGGGGGGGGAGGAGGGGGCTGGGGGAGAGGAAAGAGAGAAGGGGGAAGAAAAATACAGAGGAGGGGGAGGGGACGGGGCGGGGGGGGGCGGGGGCGGCTCGGTGGACGCGGGGCTCGGGGGCCGCGGCGGTCGGCGCGCGGGCCGCCCGCTGCGGACAGACAC
Full Trace Sequence: GGGCAAGGAAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGAACTCGACAGTCACGACCTTGCCCAGCATGACCACGGAGTTGCCCTCCATGAGCGCGACGCGGCCCAGACCCTCGCAGTTCTTGAACGAGTCGACGACGAAGGGCTGCATGGGCTCGAAGGTGCACTCGGCCATCTCGTTGGCCTTGATGCTCTGGGGGTTCTCCATCTTGGAGCCACCAGTCTCCTTGCCAACCTTCCAGGCGATCTTGGTCAGCTTGACGGCGGAGCGGCCCGTGCGGACGAAGGCGACCGGGCAGTAGCCGACCTTGAGCTCACCGGGGTGGTTCATGATCTGCACCTGGACGGTGAAGTTCTTGCAGCGGCCCAAGCTCTGGTCCGATTTTAAGATCATGACGTCACCAGTGCGCGGCATATTCTTGGCGTTCAAGTTCTTGACGTTCATGCCGACGTTGTCGCCAGGGCCGGCCGACTCGACCTGCTTGTGGTGCATCTCAACAGAGAACACCTTGCCGGTGCAGGCGGTGGAGGGGGTGTGGGTGGGCCGGAAGATGGCTGGAAAACGGACTTTGTCGGGGCCCTCGGTGCCACGGCCCCCTCCCCGGCGGGGACGCCGATAAACGTGAAACCGACTACAAAAGAAAGAAAGGGGGGGAGGGGGGGGAGGCGGGCGGGGGGCAGAAAAACTACCCATCGAGGGGCTGGAAAGTGGCTGGGAGAAAAAAGGGGCTTTTGGCGAAAAAACAGGAGACACCCCACACGGGAGGACTGGGGGGGGGGGTCGGAAAAAGGGGGGGAGGGAACGGGGGAAGGGGGGGGGGGAGGGAGGGGGGTAAGAACGGGTATAAATCCCCTCCGGGGGCGAGCACAAAAGCCCCGCCGTGGGGCGGGGAGGGGGGGGTGGGGGGGGGGGGAAACAACGGGGGGGGCGTCCGCGGGTGGGAAAAGAAACAAATAATGGGGCAGAAAAATTAAAAAAAGGGAAAAGAGCGCGGGGGGGGGGGGGGGGGGGGGTAGGAAGGGGAGGGGCACAAAGAGGGAGGGGGGGGGTGGGGGGGGGGAGGAGGGGGCTGGGGGAGAGGAAAGAGAGAAGGGGGAAGAAAAATACAGAGGAGGGGGAGGGGACGGGGCGGGGGGGGGCGGGGGCGGCTCGGTGGACGCGGGGCTCGGGGGCCGCGGCGGTCGGCGCGCGGGCCGCCCGCTGCGGACAGACAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGAACTCGACAGTCACGACCTT