ORFeome > LOC100036904 ORF1 – XORFeome v1.0

LOC100036904 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255875
Gene Page ID:
ORF Xenbase ID: 17254467

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129626
Original XGC clone length: 1008

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ837829
dbEST ID: 79655531
Trimmed Sequence: ATGGTACTGCTGCCTACAAGCCTTACAGAAGAAGAGGAGGCTTTGCAGAGGAAGTTTGCAAAGTTGAAAAAGAAAAAAAAAGCCCTTCTTGCTTTAAAGAAGCAAACATCTACTAACCAGACAAGCCAGACTGGTATTAAGAGATCTCTGTCGGACCAGCCTGCAGTTGACACAGCTACAGCTACAGAACAAGCAAAGATGTTAGTGAAGACTGGAGCAATCAGCGCTATAAAGTCAGGGACAAAAAACAGTGGCTTCAAACGTTCTCGAACCTTGGAAGGCAAACTCAAGGACCCTGATAAGGGACCTGCTCCAAGCTTCCAGCCTTTCCAGCGCAGCATTTCTGTAGATGAGGAACAGACAGAGGGTTCCAGAAGATCTCAGAGAAAATCACTCTATGAAAGTTTTGTCAGCCCCAGTGAACGCATGCAAGATGTTGAGAGAGAAAGTGAGGAACAAGAGAGCGACAAGGATACCCGTCAAGGAGAAAAGGAACTTTTAGACAGAGAACCTTTTGATAAAGACCGTGGAAGAGAGAGAGATCGTGATCGGGACAGAGAAAGAGATCGAGACCGCAGTGAGAGAGACCGGGAAAAAGATCACGAAAGGGACAGAGATGGCTTTTACCGCAGATCAGATTCATTCCCTGAACGTCGGGCCCCGAAGAAAGGTAATACTGTTTATGTCCATGGTGTGGGCATGAGCCCGAACATGCTTCATGAAGCTTTTTTCAGCTTTGGAAACATTATTTGAATCTTTCCTTGGGATGCTTCCAGGGGAAAGTGTGCCTTTTTGTTCCCTTTTTTAAAAAAA
Full Trace Sequence: TCGAGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTACTGCTGCCTACAAGCCTTACAGAAGAAGAGGAGGCTTTGCAGAGGAAGTTTGCAAAGTTGAAAAAGAAAAAAAAAGCCCTTCTTGCTTTAAAGAAGCAAACATCTACTAACCAGACAAGCCAGACTGGTATTAAGAGATCTCTGTCGGACCAGCCTGCAGTTGACACAGCTACAGCTACAGAACAAGCAAAGATGTTAGTGAAGACTGGAGCAATCAGCGCTATAAAGTCAGGGACAAAAAACAGTGGCTTCAAACGTTCTCGAACCTTGGAAGGCAAACTCAAGGACCCTGATAAGGGACCTGCTCCAAGCTTCCAGCCTTTCCAGCGCAGCATTTCTGTAGATGAGGAACAGACAGAGGGTTCCAGAAGATCTCAGAGAAAATCACTCTATGAAAGTTTTGTCAGCCCCAGTGAACGCATGCAAGATGTTGAGAGAGAAAGTGAGGAACAAGAGAGCGACAAGGATACCCGTCAAGGAGAAAAGGAACTTTTAGACAGAGAACCTTTTGATAAAGACCGTGGAAGAGAGAGAGATCGTGATCGGGACAGAGAAAGAGATCGAGACCGCAGTGAGAGAGACCGGGAAAAAGATCACGAAAGGGACAGAGATGGCTTTTACCGCAGATCAGATTCATTCCCTGAACGTCGGGCCCCGAAGAAAGGTAATACTGTTTATGTCCATGGTGTGGGCATGAGCCCGAACATGCTTCATGAAGCTTTTTTCAGCTTTGGAAACATTATTTGAATCTTTCCTTGGGATGCTTCCAGGGGAAAGTGTGCCTTTTTGTTCCCTTTTTTAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTACTGCTGCCTACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837828
dbEST ID: 79655530
Trimmed Sequence: AAAAATATCTTCAGAGTAATTGACTTGAGACCTCTTATCTCTGTGAGAACCTTTCACACTGTTCTGTACAGCCAATGAACCCCAAACTGATTTTCCTGTAGCTGCCTCCAACATTGGCTGTTTCCGAGCTATGCTGACCTTTACCGGTATGTCTTCTATCGACTTGTTATTAAGCCCTGCAATAGCCTGGTCAGCTGACTCCATCTTCTCATAAGTAACAAAAGCACAGTTCCTTGGAGCATCCAAAGAAAGATCAATAATGTTTCCAAAGCTGGAAAAAGCCTCATGAAGCATTGTCTGGCTCATGCCCACACCATGGACATAAACAGTATTACCTTTCCTCGGGGCCCGACGTTCAGGGAATGAATCTGATCTGCGGTAAAAGCCATCTCTGTCCCTTTCGTGATCTTTTTCCCGGTCTCTCTCACTGCGGTCTCGATCTCTTTCTCTGTCCCGATCACGATCTCTCTCTCTTCCACGGTCTTTATCAAAAGGTTCTCTGTCTAAGAGTTCCTTTTCTCCTTGACGGGTATCCTTGTCGCTCTCTTGTTCCTCACTTTCTCTCTCAACATCTTGCATGCGTTCACTGGGGCTGACAAAACTTTCATAGAATGATTTTCTCTGAGATCTTCTGGAACCCTCTGTCTGTTCCTCATCTACAAAAATGCTGCGCTGGAGAGGCTGGAAGCTTGGAACAGGTCCCTTATCATGGTCCTTGAATTTGCCTTCCAAGGTTCGAGAAGGGTGGAAAGCCCTGTTTTTTGTCCCTGGACTTTAAACCGCTTATTGCTCCCGTCTTTCCTAACATCTTTGCCTGTTTCTGGAGCTGGTGCTGTGTTCACTGGAGGGCGGGGCCAAGGGAAATCCCTTAAAACCAGACCTGGCTGTGGGGGTGAGAAAAGGTTTGCTTCTTTAAAAGAAAAAGGGCTTTTTTTTGGGTTTTCTACTTTTCCAGCTTTCCTCGGCGGACCCCCCGCCGTCGCCGGGTAAGGTTGGTAGGGGGGGGAGGGCGGGGGGGGACAACTTTTTTGTTGGAGAGTTTGGCAATATGGAGAAAGAGGATTTGCATAACAAAATTTTGGGTTGCGGCGGAAAAGAAGGGACAAAAAAGAAAAAAACAAAAAAAAAAAAAAACAAATAAGTTAAGAAAGAAAACAGAAAAAAATTAAAAAAAAAAAAAACCAGCCGACAAACAATAATGTTGAAAGAAAAAAAAG
Full Trace Sequence: GGGCAGGGAAACAGCTATGGACCATGTAATACGACTCACTATNAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAAATATCTTCAGAGTAATTGACTTGAGACCTCTTATCTCTGTGAGAACCTTTCACACTGTTCTGTACAGCCAATGAACCCCAAACTGATTTTCCTGTAGCTGCCTCCAACATTGGCTGTTTCCGAGCTATGCTGACCTTTACCGGTATGTCTTCTATCGACTTGTTATTAAGCCCTGCAATAGCCTGGTCAGCTGACTCCATCTTCTCATAAGTAACAAAAGCACAGTTCCTTGGAGCATCCAAAGAAAGATCAATAATGTTTCCAAAGCTGGAAAAAGCCTCATGAAGCATTGTCTGGCTCATGCCCACACCATGGACATAAACAGTATTACCTTTCCTCGGGGCCCGACGTTCAGGGAATGAATCTGATCTGCGGTAAAAGCCATCTCTGTCCCTTTCGTGATCTTTTTCCCGGTCTCTCTCACTGCGGTCTCGATCTCTTTCTCTGTCCCGATCACGATCTCTCTCTCTTCCACGGTCTTTATCAAAAGGTTCTCTGTCTAAGAGTTCCTTTTCTCCTTGACGGGTATCCTTGTCGCTCTCTTGTTCCTCACTTTCTCTCTCAACATCTTGCATGCGTTCACTGGGGCTGACAAAACTTTCATAGAATGATTTTCTCTGAGATCTTCTGGAACCCTCTGTCTGTTCCTCATCTACAAAAATGCTGCGCTGGAGAGGCTGGAAGCTTGGAACAGGTCCCTTATCATGGTCCTTGAATTTGCCTTCCAAGGTTCGAGAAGGGTGGAAAGCCCTGTTTTTTGTCCCTGGACTTTAAACCGCTTATTGCTCCCGTCTTTCCTAACATCTTTGCCTGTTTCTGGAGCTGGTGCTGTGTTCACTGGAGGGCGGGGCCAAGGGAAATCCCTTAAAACCAGACCTGGCTGTGGGGGTGAGAAAAGGTTTGCTTCTTTAAAAGAAAAAGGGCTTTTTTTTGGGTTTTCTACTTTTCCAGCTTTCCTCGGCGGACCCCCCGCCGTCGCCGGGTAAGGTTGGTAGGGGGGGGAGGGCGGGGGGGGACAACTTTTTTGTTGGAGAGTTTGGCAATATGGAGAAAGAGGATTTGCATAACAAAATTTTGGGTTGCGGCGGAAAAGAAGGGACAAAAAAGAAAAAAACAAAAAAAAAAAAAAACAAATAAGTTAAGAAAGAAAACAGAAAAAAATTAAAAAAAAAAAAAACCAGCCGACAAACAATAATGTTGAAAGAAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAAATATCTTCAGAGTAATTGAC