ORFeome > LOC100036932 ORF1 – XORFeome v1.0

LOC100036932 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5872962
Gene Page ID: 5872931
ORF Xenbase ID: 17254479

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129682
Original XGC clone length: 1215

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ838699
dbEST ID: 79656401
Trimmed Sequence: ATGTCTGGGATTTACAGCGAAGTTGCTGCGGATGAGAACACCAGCGACAGTTTCTGGATGCCCAATAACTACAGTAGCACGGTGAAGCGCACAGAAGATGGCCACCGGCTTTGCGATGAAATTGTAGCGTGTTTCCAAGACAGAGCCAAGATTGAGCGTCAGTATGCTCTCCAGATGGAGGAATGGACCCACAAGTGGAAACCTCTGGTAGACAGCAGCCCTATGTATGGTTCTCTCCTGCGTGCCTGGCAGGCCTTTATGAGCGCCACAGAACGTCTCAGTGAGCTCCATACGCAGATCCAGAAGACGCTGGTAGCAGAGGATTCAGAGAAGATACGCACGTGGCAGAAGGAGACATATCATCGCAAGATATTTGGAGGGTTCAAGGAGTCCTGTGAGATTGAGAATGGGTTCCACAAGGCACAAAAGCCATGGGCCAAAAAGTTAAAGAAGGTGGAAAATTCCAAGGCTGCTTACCACAAAGCCTGTAAGAAGGAGCACTTGGCCATTGTCCGAGAGAACAGCTCCAAAATAAACCCGGAACTGTCCCAAGAGAAATTGAAGAAACTCACAGAGGATCATGAGAAATGCACACAGGACAAAGAAAAGGTAAAGCAGAAGTATTAGAAGTCCCTACAGGAACTGAATAAGTATAATCCCTAATTATATGGAAAGAAATGGAAAACGTTGGTTGATCAGAAGCCCGCCACCAGA
Full Trace Sequence: CTCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGGGATTTACAGCGAAGTTGCTGCGGATGAGAACACCAGCGACAGTTTCTGGATGCCCAATAACTACAGTAGCACGGTGAAGCGCACAGAAGATGGCCACCGGCTTTGCGATGAAATTGTAGCGTGTTTCCAAGACAGAGCCAAGATTGAGCGTCAGTATGCTCTCCAGATGGAGGAATGGACCCACAAGTGGAAACCTCTGGTAGACAGCAGCCCTATGTATGGTTCTCTCCTGCGTGCCTGGCAGGCCTTTATGAGCGCCACAGAACGTCTCAGTGAGCTCCATACGCAGATCCAGAAGACGCTGGTAGCAGAGGATTCAGAGAAGATACGCACGTGGCAGAAGGAGACATATCATCGCAAGATATTTGGAGGGTTCAAGGAGTCCTGTGAGATTGAGAATGGGTTCCACAAGGCACAAAAGCCATGGGCCAAAAAGTTAAAGAAGGTGGAAAATTCCAAGGCTGCTTACCACAAAGCCTGTAAGAAGGAGCACTTGGCCATTGTCCGAGAGAACAGCTCCAAAATAAACCCGGAACTGTCCCAAGAGAAATTGAAGAAACTCACAGAGGATCATGAGAAATGCACACAGGACAAAGAAAAGGTAAAGCAGAAGTATTAGAAGTCCCTACAGGAACTGAATAAGTATAATCCCTAATTATATGGAAAGAAATGGAAAACGTTGGTTGATCAGAAGCCCGCCACCAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGGATTTACAGCGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838698
dbEST ID: 79656400
Trimmed Sequence: TCCAGAAATCACTTCCACATAGTTGGCAGGGTAAAGTCCTACTTGTCCTTTATCTGTCACTCCTTTGCACCAGCCTTGCTCATCTTCATCCTCAATCTTTGTGAGGTCATCACCTGCTTTAAAACTGAGCTCATCAGATTCCTGCCCTGAATAATCATATACGGCTCGAACACGCACCCCAGGAACATTGATAGGAGCTTTATTCTGACTGCTTTCTGTAGGCGTTACACTGTATAACTTCACCTTGTCTGTCTCTTTCACTGTCTTCTTTTTCACAATTTGTTGCTCTGTGTCCGGAGTCCACTCCTTCAGCTGAGGCCAGTTCATTATCATTCCAGGCCCGTGCTTGTTCTTCCACCATTTTAGATCCTCTTGGTCATTTACAGCGACAATTGCGTCATTTAAATCCCCATACACTGTCTTTGCACTCTCATTAGTGGTGATATCCAGATGTTTGTGCATAGACCCAAGGACCTGTTTGAGAAAGAGAATCTTCTTCTGCTCCTGTTGCTGGCTCTGATCAAACACTGTTTCCATTTCTTCCATATACTTAGGATTATACTTATTCAGTTTCCTGTAGGGACTTCTCATACCTCTGCTTTACCTTTCCTTTGTCCTGTGTGCATTTCTCATGAACCTCTGTGGATTTCTCCACCTTCCCCTTGGGAACATTCCCGGGTTAATTTTTTTGAACCTGTGTTTCCCGGAA
Full Trace Sequence: GGAAACCAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCAGAAATCACTTCCACATAGTTGGCAGGGTAAAGTCCTACTTGTCCTTTATCTGTCACTCCTTTGCACCAGCCTTGCTCATCTTCATCCTCAATCTTTGTGAGGTCATCACCTGCTTTAAAACTGAGCTCATCAGATTCCTGCCCTGAATAATCATATACGGCTCGAACACGCACCCCAGGAACATTGATAGGAGCTTTATTCTGACTGCTTTCTGTAGGCGTTACACTGTATAACTTCACCTTGTCTGTCTCTTTCACTGTCTTCTTTTTCACAATTTGTTGCTCTGTGTCCGGAGTCCACTCCTTCAGCTGAGGCCAGTTCATTATCATTCCAGGCCCGTGCTTGTTCTTCCACCATTTTAGATCCTCTTGGTCATTTACAGCGACAATTGCGTCATTTAAATCCCCATACACTGTCTTTGCACTCTCATTAGTGGTGATATCCAGATGTTTGTGCATAGACCCAAGGACCTGTTTGAGAAAGAGAATCTTCTTCTGCTCCTGTTGCTGGCTCTGATCAAACACTGTTTCCATTTCTTCCATATACTTAGGATTATACTTATTCAGTTTCCTGTAGGGACTTCTCATACCTCTGCTTTACCTTTCCTTTGTCCTGTGTGCATTTCTCATGAACCTCTGTGGATTTCTCCACCTTCCCCTTGGGAACATTCCCGGGTTAATTTTTTTGAACCTGTGTTTCCCGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCAGAAATCACTTCCACATAGTT