ORFeome > LOC100036987 ORF1 – XORFeome v1.0

LOC100036987 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255838
Gene Page ID:
ORF Xenbase ID: 17254521

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129785
Original XGC clone length: 507

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ838924
dbEST ID: 79656626
Trimmed Sequence: ATGGCGGCTCTCAGTGCCCGCTGGGTGAGAGGTCTGACCCGCAGATCTGCCTTTGGAGTGTGTTTCGGCAGCAGGGATCGCGCTGCTTTTCTGCTGCAGAGATCGGCAGTGAGAGCAGCATCTGGTGTTTCAAAGAATGACTTGCCAGGACCATATCCAAATACTCCAGAGGAAAGAGCAGCTGCAGCTAAGAAATACAACATGAGGGTGGAAGACTATGAGCCTTACCCAGATGATGGAATGGGCTTTGGTGATTATCCAAAACTTCCTGAAAAATCTCAGCAAGAAAGGGACCCATGGTACTCTTGGGATCACCCTGACCTCAGGAGAAATTGGGGGGAACCGATTCAATGGGACTTTGACATGTATACCAGAAACCGGGTTGATACGTCGCCTACAGCTCTACCTTGGAATACTATGTGCAAATACCTCTTTGGATTTATTGGGTTTATGCTCTTCATGTTCTGGGTTGGAGAAAAGTATCCAGTGTATCCTCCTGTGGTATT
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCTCAGTGCCCGCTGGGTGAGAGGTCTGACCCGCAGATCTGCCTTTGGAGTGTGTTTCGGCAGCAGGGATCGCGCTGCTTTTCTGCTGCAGAGATCGGCAGTGAGAGCAGCATCTGGTGTTTCAAAGAATGACTTGCCAGGACCATATCCAAATACTCCAGAGGAAAGAGCAGCTGCAGCTAAGAAATACAACATGAGGGTGGAAGACTATGAGCCTTACCCAGATGATGGAATGGGCTTTGGTGATTATCCAAAACTTCCTGAAAAATCTCAGCAAGAAAGGGACCCATGGTACTCTTGGGATCACCCTGACCTCAGGAGAAATTGGGGGGAACCGATTCAATGGGACTTTGACATGTATACCAGAAACCGGGTTGATACGTCGCCTACAGCTCTACCTTGGAATACTATGTGCAAATACCTCTTTGGATTTATTGGGTTTATGCTCTTCATGTTCTGGGTTGGAGAAAAGTATCCAGTGTATCCTCCTGTGGTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATACTGAGTCGTATACCTGGGTCATAGCTGTTACCTTGGCACCTCTAGAAAAAAAAAAAACAAAAAAAAAAGTTAAAAAAGAAAACACGGCCCCCCCCCCCCGCCNGGNNGCGTTTTCTTTCCCTTCTTCCCTTCTCCCTTTTTTTTTGTTTGTGGGTGTGTGTCGGCGGGCGTCGGACCCAAAAAAAACAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCTCAGTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838923
dbEST ID: 79656625
Trimmed Sequence: TACCACAGGAGGATACACTGGATACTTTTCTCCAACCCAGAACATGAAGAGCATAAACCCAATAAATCCAAAGAGGTATTTGCACATAGTATTCCAAGGTAGAGCTGTAGGCGACGTATCAACCCGGTTTCTGGTATACATGTCAAAGTCCCATTGAATCGGTTCCCCCCAATTTCTCCTGAGGTCAGGGTGATCCCAAGAGTACCATGGGTCCCTTTCTTGCTGAGATTTTTCAGGAAGTTTTGGATAATCACCAAAGCCCATTCCATCATCTGGGTAAGGCTCATAGTCTTCCACCCTCATGTTGTATTTCTTAGCTGCAGCTGCTCTTTCCTCTGGAGTATTTGGATATGGTCCTGGCAAGTCATTCTTTGAAACACCAGATGCTGCTCTCACTGCCGATCTCTGCAGCAGAAAAGCAGCGCGATCCCTGCTGCCGAAACACACTCCAAAGGCAGATCTGCGGGTCAGACCTCTCACCCAGCGGGCACTGAGAGCCGCCATGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACCACAGGAGGATACACTGGATACTTTTCTCCAACCCAGAACATGAAGAGCATAAACCCAATAAATCCAAAGAGGTATTTGCACATAGTATTCCAAGGTAGAGCTGTAGGCGACGTATCAACCCGGTTTCTGGTATACATGTCAAAGTCCCATTGAATCGGTTCCCCCCAATTTCTCCTGAGGTCAGGGTGATCCCAAGAGTACCATGGGTCCCTTTCTTGCTGAGATTTTTCAGGAAGTTTTGGATAATCACCAAAGCCCATTCCATCATCTGGGTAAGGCTCATAGTCTTCCACCCTCATGTTGTATTTCTTAGCTGCAGCTGCTCTTTCCTCTGGAGTATTTGGATATGGTCCTGGCAAGTCATTCTTTGAAACACCAGATGCTGCTCTCACTGCCGATCTCTGCAGCAGAAAAGCAGCGCGATCCCTGCTGCCGAAACACACTCCAAAGGCAGATCTGCGGGTCAGACCTCTCACCCAGCGGGCACTGAGAGCCGCCATGGTGCCNACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATCATTATTTGGGGGCCGAGCTAAAAACTGGACAACGTTTAAAAACCAAAAAAAAGAACAAAAGAAAAAAAAAAAGNNCNCCCTTAGCCCATGACAAAAAGAACAAAAAAAAATATAAAACCGGCCTCTTTCTTATCGTTCTGCTCTCTTGTTTGGTGGGTGGGGGGGGGTTGCGGGGGGGAAAAAAAGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACCACAGGAGGATACACTGGA