ORFeome > LOC100036989 ORF1 – XORFeome v1.0

LOC100036989 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 990432
Gene Page ID: 990428
ORF Xenbase ID: 17254527

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129793
Original XGC clone length: 426

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ838906
dbEST ID: 79656608
Trimmed Sequence: ATGTCCATGGAGAACACTGACACCACTGATAAGCCTCCTCCGTACATGGTGGAGCCACCTTCTAACTCCGTCAACCAAGGATTTGACCCATCTAGGGCAGGGGTGATGGGGATTCCCAATGTCCCAGCTCCACAAGTCCATACCACAGTGGTGAACATCATTCCCGATGGATTTCTCATACGAGACCACTTGCCATGGTCCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATTTTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGAGGCTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCATGGAGAACACTGACACCACTGATAAGCCTCCTCCGTACATGGTGGAGCCACCTTCTAACTCCGTCAACCAAGGATTTGACCCATCTAGGGCAGGGGTGATGGGGATTCCCAATGTCCCAGCTCCACAAGTCCATACCACAGTGGTGAACATCATTCCCGATGGATTTCTCATACGAGACCACTTGCCATGGTCCATTTTTAACACCATGTACATGAACTTCTGCTGCCTGGGGTTCTTTGCAGTTATTTTCTCTGTAAAGTCCCGGGATCAGAAGGTGATTGGAGACAGGTCTGGAGCCATGAGTTATGCTTCTACTGCCCGTAATCTCAACATCGCCGCTTCTTTTTTCACCATCATTACTATTATTGTTGTGTTAATCATTTTACCACCTACATCCTGGTCACAGAACAGAGGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTAGAAAAAAAGAACACATGTCTCAATCTTTTTAAGGTTCAAGCCCGCCCCGAGAAAAAAAAGGCCTTCTTCTCAAAAGGGGGGGTTTTGTTGGTTGTGTTGGGATAAAAAAAAAAAAAAAAAAAAAAAAAAAATCAGCGTTTTTTTTCTTTTGAAAAAAGGGGGGGGGGGGGGGGCCCCCCCCCCCCCAATACCTCCCCAGCCGGGGGGGGGGTGGGGGGGTGGGGGGGGGTTTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCATGGAGAACACTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838905
dbEST ID: 79656607
Trimmed Sequence: GCCTCTGTTCTGTGACCAGGATGTAGGTGGTAAAATGATTAACACAACAATAATAGTAATGATGGTGAAAAAAGAAGCGGCGATGTTGAGATTACGGGCAGTAGAAGCATAACTCATGGCTCCAGACCTGTCTCCAATCACCTTCTGATCCCGGGACTTTACAGAGAAAATAACTGCAAAGAACCCCAGGCAGCAGAAGTTCATGTACATGGTGTTAAAAATGGACCATGGCAAGTGGTCTCGTATGAGAAATCCATCGGGAATGATGTTCACCACTGTGGTATGGACTTGTGGAGCTGGGACATTGGGAATCCCCATCACCCCTGCCCTAGATGGGTCAAATCCTTGGTTGACGGAGTTAGAAGGTGGCTCCACCATGTACGGAGGAGGCTTATCAGTGGTGTCAGTGTTCTCCATGGACATGG
Full Trace Sequence: GTGAAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCTCTGTTCTGTGACCAGGATGTAGGTGGTAAAATGATTAACACAACAATAATAGTAATGATGGTGAAAAAAGAAGCGGCGATGTTGAGATTACGGGCAGTAGAAGCATAACTCATGGCTCCAGACCTGTCTCCAATCACCTTCTGATCCCGGGACTTTACAGAGAAAATAACTGCAAAGAACCCCAGGCAGCAGAAGTTCATGTACATGGTGTTAAAAATGGACCATGGCAAGTGGTCTCGTATGAGAAATCCATCGGGAATGATGTTCACCACTGTGGTATGGACTTGTGGAGCTGGGACATTGGGAATCCCCATCACCCCTGCCCTAGATGGGTCAAATCCTTGGTTGACGGAGTTAGAAGGTGGCTCCACCATGTACGGAGGAGGCTTATCAGTGGTGTCAGTGTTCTCCATGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCCGACCTTAAAAAAAAAAAAACGTTATAAATAAAATAAACTAGGAGGAGAGCCCGGCGCGGGAAAAAAAAAAACCCCCCCTCTCTCCACAAACGGGTTCCGGTTTGTAACTTACAGAAAAAAAAAAGCTCCCGCCCAAAACAAAAGAACACAAACACAGGGTGGTTGTTCTGTGTGTAAGAATAAAAACAGAAGGGGGCCGCCGCCCCCTGCGCGCCGCAAACAACTACACTTAACGCCGCCCCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCTCTGTTCTGTGACC