ORFeome > LOC100037000 ORF1 – XORFeome v1.0

LOC100037000 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5945955
Gene Page ID: 5945946
ORF Xenbase ID: 17254545

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130085
Original XGC clone length: 324

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ837620
dbEST ID: 79655322
Trimmed Sequence: ATGAGTGCTAAAATATTTGCTGCCACTTTTGCTTTTTGCCTGCTTTATACAGCATTTTCTGAAGGTGTGTATAAAATAAAAAAATCGTCAGCCCTACGGTGTCAGTGCTTAACGACCCACTCTGCTTTCATCCCACCTCGACTGTACAAAAGTGTGGAACTTATACCCAGTGGACCCCACTGCAAAAATCTAGAAGTCATAATCACAATTAAATCTGGGGAACGTGTGTGTGTGGATCCATCTCAGCGCTGGGTAGAAAGGATTATCAACAGCATATTAGAAAGCAACAGAAATGAAGAGCCAGTGACTCAAACAGATCGCTT
Full Trace Sequence: GTTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGCTAAAATATTTGCTGCCACTTTTGCTTTTTGCCTGCTTTATACAGCATTTTCTGAAGGTGTGTATAAAATAAAAAAATCGTCAGCCCTACGGTGTCAGTGCTTAACGACCCACTCTGCTTTCATCCCACCTCGACTGTACAAAAGTGTGGAACTTATACCCAGTGGACCCCACTGCAAAAATCTAGAAGTCATAATCACAATTAAATCTGGGGAACGTGTGTGTGTGGATCCATCTCAGCGCTGGGTAGAAAGGATTATCAACAGCATATTAGAAAGCAACAGAAATGAAGAGCCAGTGACTCAAACAGATCGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGACAAAATCAAAAAATCATATAATATTACAGCATCACGGAACCGCCCAGGGACAGAAAAGACAAAAAATAATTCCACAAAATGTTGGCTGTGGACTTATCCCGTGTTAGTCGGATGAAGGGCAAAAAAGCAACGACAAAACCCCCCGTACGCTGCTTTAGATGGTTTGGAAAGACGATAACCCCCCGGGCCACCCGGGCCCGAAACCTTGAACAAACTGGGGGGGTGGTGACCGGGTGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGCTAAAATATTTGCTGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837619
dbEST ID: 79655321
Trimmed Sequence: GCGATCTGTTTGAGTCACTGGCTCTTCATTTCTGTTGCTTTCTAATATGCTGTTGATAATCCTTTCTACCCAGCGCTGAGATGGATCCACACACACACGTTCCCCAGATTTAATTGTGATTATGACTTCTAGATTTTTGCAGTGGGGTCCACTGGGTATAAGTTCCACACTTTTGTACAGTCGAGGTGGGATGAAAGCAGAGTGGGTCGTTAAGCACTGACACCGTAGGGCTGACGATTTTTTTATTTTATACACACCTTCAGAAAATGCTGTATAAAGCAGGCAAAAAGCAAAAGTGGCAGCAAATATTTTAGCACTCATGG
Full Trace Sequence: CGGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGATCTGTTTGAGTCACTGGCTCTTCATTTCTGTTGCTTTCTAATATGCTGTTGATAATCCTTTCTACCCAGCGCTGAGATGGATCCACACACACACGTTCCCCAGATTTAATTGTGATTATGACTTCTAGATTTTTGCAGTGGGGTCCACTGGGTATAAGTTCCACACTTTTGTACAGTCGAGGTGGGATGAAAGCAGAGTGGGTCGTTAAGCACTGACACCGTAGGGCTGACGATTTTTTTATTTTATACACACCTTCAGAAAATGCTGTATAAAGCAGGCAAAAAGCAAAAGTGGCAGCAAATATTTTAGCACTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACAGAACATCATTTTACAACTCACTGACAGGTGCGAAAATCCCAGCGATCAAAAAACTAAAAGCCAAACAGACACAGGTGCGGTTGTGTTCCTTGTTGTTAGAGGGGGAAAGCCCCCACCCCAAGGGAAAAACCCGGGGCGCTCCTAGCAAGGATGGGAGTAAATTATCCGTCCCCTCCGCCGGGGCCGAAAAACTGAACACAAACCCAGGGGGGGGGAAAAGGCGAGGGGGGCGGGGTTGGGGGGGGGTTTATTGAATAGGTTTTTTTTTTGGAGACCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGATCTGTTTGAGTCACTGG