ORFeome > LOC100037141 ORF1 – XORFeome v1.0

LOC100037141 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 6255259
Gene Page ID: 5847736
ORF Xenbase ID: 17254671

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133205
Original XGC clone length: 1350

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ838525
dbEST ID: 79656227
Trimmed Sequence: ATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATCGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACATGGCATCCAGCCTGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGAGCTGGCAAGCATGTGCCCCGGGCAGTGTTCGTAGACCTGGAACCCACGGTCATCGATGAAGTTCGCACCGGCACCTACCGCCAGCTCTTCCATCCTGAGCAGCTCATCACAGGCAAGGAGGATGCTGCCAATAACTATGCCCGTGGCCACTACACCATTGGCAAGGAGATCATTGACCTTGTCCTGGACAGGATTCGAAAGCTGGCTGACCAGTGCACGGGTCTCCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGCTCTGGCTTCACCTCCCTGCTGATGGAGCGGCTCTCTGTGGATTACGGAAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACTGCTGTGGTTGAGCCCTACAATTCCATCCTCACCACCCACACCACCCTGGAACACTCTGATTGTGCCTTCATGGAGACAATGAGGCCATCTATGACATCTTCGTAGAAACCTCGACATTGAGCGCCCAACCCTAGACCACCCTAACCGCCTTATTACCCAGATTGTGTCTTTCCATCACTCTTTCCCCTCAATTTGAAGGGGGCCCTGAAAGGTTAAACTTAACAGAATTTCAAAAACAACCCGGATAACCCAAACCCCCCCCCACCCACCTTCCCCCCTTGCC
Full Trace Sequence: CGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATCGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACATGGCATCCAGCCTGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGAGCTGGCAAGCATGTGCCCCGGGCAGTGTTCGTAGACCTGGAACCCACGGTCATCGATGAAGTTCGCACCGGCACCTACCGCCAGCTCTTCCATCCTGAGCAGCTCATCACAGGCAAGGAGGATGCTGCCAATAACTATGCCCGTGGCCACTACACCATTGGCAAGGAGATCATTGACCTTGTCCTGGACAGGATTCGAAAGCTGGCTGACCAGTGCACGGGTCTCCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGCTCTGGCTTCACCTCCCTGCTGATGGAGCGGCTCTCTGTGGATTACGGAAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACTGCTGTGGTTGAGCCCTACAATTCCATCCTCACCACCCACACCACCCTGGAACACTCTGATTGTGCCTTCATGGAGACAATGAGGCCATCTATGACATCTTCGTAGAAACCTCGACATTGAGCGCCCAACCCTAGACCACCCTAACCGCCTTATTACCCAGATTGTGTCTTTCCATCACTCTTTCCCCTCAATTTGAAGGGGGCCCTGAAAGGTTAAACTTAACAGAATTTCAAAAACAACCCGGATAACCCAAACCCCCCCCCACCCACCTTCCCCCCTTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGTGAGTGCATCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838524
dbEST ID: 79656226
Trimmed Sequence: ATATTCCTCACCCTCATCGTCTCCTTCAGCACTATCTGCCCCAACCTCCTCATAATCCTTCTCTAGGGCAGCCATGTCCTCACGGGCCTCAGAGAACTCACCCTCCTCCATGCCCTCACCCACATACCAGTGCACAAAGGCACGCTTGGCATACATCAGATCAAACTTGTGATCTAGGCGAGCCCAGGCCTCAGCAATGGCTGTGGTGTTGCTCAGCATGCACACAGCTCTCTGCACCTTGGCCAGGTCACCACCGGGTACCACAGTGGGAGGCTGGTAGTTAATGCCAACCTTGAAGCCAGTGGGGCACCAGTCCACAAACTGGATGGTACGCTTGGTCTTGATGGTGGCAATGGCAGCATTGACATCTTTGGGAACCACATCACCACGGTACAGCAGGCAGCAAGCCATGTATTTACCATGGCGAGGGTCACATTTCACCATCTGGTTGGCTGGCTCAAAGCAGGCATTGGTGATCTCTGCTACTGTAAGCTGCTCGTGGTAGGCTTTCTCAGCAGAGATGACAGGNGCATAAGTGGCCAGAGGGAAGTGGATGCGAGGGTANGGTAACCAGGTTGGTCTGGAATTCTGTCAGATCAACATTCAGGGCCCCATCAAATCTGAAAGGAGCAGTGATGGAAGACACAATCTGCCTAATAAGGCGGTTTAAGGTTTGGTGTAAGTTGGGCGCCCCAAATGTTCAAGTTTTCCACCACCGAAATTTCAAAAAAATGCCCTCATTGTTCCAACATGAAAGGCCCAACC
Full Trace Sequence: AAAAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATATTCCTCACCCTCATCGTCTCCTTCAGCACTATCTGCCCCAACCTCCTCATAATCCTTCTCTAGGGCAGCCATGTCCTCACGGGCCTCAGAGAACTCACCCTCCTCCATGCCCTCACCCACATACCAGTGCACAAAGGCACGCTTGGCATACATCAGATCAAACTTGTGATCTAGGCGAGCCCAGGCCTCAGCAATGGCTGTGGTGTTGCTCAGCATGCACACAGCTCTCTGCACCTTGGCCAGGTCACCACCGGGTACCACAGTGGGAGGCTGGTAGTTAATGCCAACCTTGAAGCCAGTGGGGCACCAGTCCACAAACTGGATGGTACGCTTGGTCTTGATGGTGGCAATGGCAGCATTGACATCTTTGGGAACCACATCACCACGGTACAGCAGGCAGCAAGCCATGTATTTACCATGGCGAGGGTCACATTTCACCATCTGGTTGGCTGGCTCAAAGCAGGCATTGGTGATCTCTGCTACTGTAAGCTGCTCGTGGTAGGCTTTCTCAGCAGAGATGACAGGNGCATAAGTGGCCAGAGGGAAGTGGATGCGAGGGTANGGTAACCAGGTTGGTCTGGAATTCTGTCAGATCAACATTCAGGGCCCCATCAAATCTGAAAGGAGCAGTGATGGAAGACACAATCTGCCTAATAAGGCGGTTTAAGGTTTGGTGTAAGTTGGGCGCCCCAAATGTTCAAGTTTTCCACCACCGAAATTTCAAAAAAATGCCCTCATTGTTCCAACATGAAAGGCCCAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATTCCTCACCCTCATCGTCT