ORFeome > LOC100037189 ORF1 – XORFeome v1.0

LOC100037189 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 984220
Gene Page ID: 984217
ORF Xenbase ID: 17254707

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129606
Original XGC clone length: 1515

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ838649
dbEST ID: 79656351
Trimmed Sequence: ATGAATCTCATTCCTCACCTGTCAACAGGGACATGGATTCTCCTGGCTGCTCTTTTTTTGCTTATATTACTCTATGGCATTTGGCCATATGGATTCTTTAAGAAAATGGGAATTCCTGGACCTACTCCATTGCCGTTCATAGGAACATTTCTGGAATTTAGGAAAGGGATGGTACAGTTTGATACAGAATGCTTCAAAAAATATGGGAAGATGTGGGGAACTTATGATGGGAGACAACCCGTGCTTGCAGTCATGGACCCTGCTATAATTAAAACTATTCTTGTGAAAGAGTTTTACACAAATTTCACAAACAGACGGAATTTTGGTTTGAATGGCCCCTTTGAGTTTGCCATCACTATTGCAGAGGATGAACAGTGGAAAAGGATTCGGAGTGTGCTCTCACCTACATTCACCAGTGGGAAACTAAAAGAGATGTTCCAGATAATGAAAGATTACTCAGATATCCTTGTGAAAAACATCCAGGGTTATGTGGACAAAGATGAGCCATGTGCAACAAAAGATGTGATTGTAGCATACAACATGGATGTCATCACCCACACCTCATTCAGTGTGAATATTGACTCCCTTAACAAACCATCAAATCCTTTTGTTATTCGCATGAAAAACCTCTTGAACAACGGGCTTGATGAGCGCAATGCTCATCTTAGTTGTTAATTTTTTCATTTCTTATAACCCTTTCTTAAGGGGCCTGAAATTTGAACTTTTGTTTGCAAAGCAATTTCCCACCAATTTTTTTTATAAATGGGTTAGCCAAAGGT
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCTCATTCCTCACCTGTCAACAGGGACATGGATTCTCCTGGCTGCTCTTTTTTTGCTTATATTACTCTATGGCATTTGGCCATATGGATTCTTTAAGAAAATGGGAATTCCTGGACCTACTCCATTGCCGTTCATAGGAACATTTCTGGAATTTAGGAAAGGGATGGTACAGTTTGATACAGAATGCTTCAAAAAATATGGGAAGATGTGGGGAACTTATGATGGGAGACAACCCGTGCTTGCAGTCATGGACCCTGCTATAATTAAAACTATTCTTGTGAAAGAGTTTTACACAAATTTCACAAACAGACGGAATTTTGGTTTGAATGGCCCCTTTGAGTTTGCCATCACTATTGCAGAGGATGAACAGTGGAAAAGGATTCGGAGTGTGCTCTCACCTACATTCACCAGTGGGAAACTAAAAGAGATGTTCCAGATAATGAAAGATTACTCAGATATCCTTGTGAAAAACATCCAGGGTTATGTGGACAAAGATGAGCCATGTGCAACAAAAGATGTGATTGTAGCATACAACATGGATGTCATCACCCACACCTCATTCAGTGTGAATATTGACTCCCTTAACAAACCATCAAATCCTTTTGTTATTCGCATGAAAAACCTCTTGAACAACGGGCTTGATGAGCGCAATGCTCATCTTAGTTGTTAATTTTTTCATTTCTTATAACCCTTTCTTAAGGGGCCTGAAATTTGAACTTTTGTTTGCAAAGCAATTTCCCACCAATTTTTTTTATAAATGGGTTAGCCAAAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCTCATTCCTCACCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838648
dbEST ID: 79656350
Trimmed Sequence: CTCTTGAGCTGACGTCCGAGAGAGAAATTTTAAAACAATTGGTTTCTTTGGCTGTAAAAAGCCTATGGTGCTGAACTCCATGGGAATCAGAGTTTCTGCACAAGGCCGGACACTGAAGTTCTGTAACATGGTGACAATAGCCACTTTCATGCTCAGGAGAGCAAATCTCATTCCTATGCAATTCCTGGGACCATCTCCAAAAGGCAGAAAGGTAAATGGAGTATGGGTTTCCCTGTTTTCTTTACTGAACCTTTCAGGGCGGAACTCTTCAGGCTCTGGCCAATACTCAGGGTCCCGCTGTAGCACATATGCTGGGATCATTGTGACTGTCCCCTTGGGGATGCTAACACCATTAATCTCAACATTCTGCTTTGAGACTCTTTCTAGTCGTCCTGCAGGGGGATACAACCTGAGGGTCTCCTGAATGACCATATCAAGATATTCCATCTGCATCAGAATGTCATAAGTAGGACTGGCCTTGTTAGGAAGAAATGAATCTATTTCCTCATGCAACCTCTGCTGAACATCAGGGTGGGTGGCGAGGCAATAAAACAGGTAAAACAGTGCTGTACTTGTGGTTTCATATCCAGCCACTATTAAGATAACTGCCTGAGCCATTATTTCTGCATCTGGCAGAACCTTTATGCCTGATGGCTTAGATCATTTTCCGTTCGTTTGTCCTAGAATCCAGCCAAAAATTTGAAATTAAATCCACACCCTTCCCACATGGACATCCCCTTTTTTTTCTTCCTTTCCCCCTCAAAGCCCTTTGTGAACGGGCCTTGC
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTGAGCTGACGTCCGAGAGAGAAATTTTAAAACAATTGGTTTCTTTGGCTGTAAAAAGCCTATGGTGCTGAACTCCATGGGAATCAGAGTTTCTGCACAAGGCCGGACACTGAAGTTCTGTAACATGGTGACAATAGCCACTTTCATGCTCAGGAGAGCAAATCTCATTCCTATGCAATTCCTGGGACCATCTCCAAAAGGCAGAAAGGTAAATGGAGTATGGGTTTCCCTGTTTTCTTTACTGAACCTTTCAGGGCGGAACTCTTCAGGCTCTGGCCAATACTCAGGGTCCCGCTGTAGCACATATGCTGGGATCATTGTGACTGTCCCCTTGGGGATGCTAACACCATTAATCTCAACATTCTGCTTTGAGACTCTTTCTAGTCGTCCTGCAGGGGGATACAACCTGAGGGTCTCCTGAATGACCATATCAAGATATTCCATCTGCATCAGAATGTCATAAGTAGGACTGGCCTTGTTAGGAAGAAATGAATCTATTTCCTCATGCAACCTCTGCTGAACATCAGGGTGGGTGGCGAGGCAATAAAACAGGTAAAACAGTGCTGTACTTGTGGTTTCATATCCAGCCACTATTAAGATAACTGCCTGAGCCATTATTTCTGCATCTGGCAGAACCTTTATGCCTGATGGCTTAGATCATTTTCCGTTCGTTTGTCCTAGAATCCAGCCAAAAATTTGAAATTAAATCCACACCCTTCCCACATGGACATCCCCTTTTTTTTCTTCCTTTCCCCCTCAAAGCCCTTTGTGAACGGGCCTTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTGAGCTGACGTCC