ORFeome > LOC100037193 ORF2 – XORFeome v1.0

LOC100037193 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6492379
Gene Page ID:
ORF Xenbase ID: 17254725

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129627
Original XGC clone length: 786

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ838703
dbEST ID: 79656405
Trimmed Sequence: ATGTGTGGGGTATCAGTGCGAGTTGTGTCCGTACTACTGACCCTCAGTGTGTGTCTCTGTTCCTCACCCCCAGAGGATTACGTGTATCAGGTGAAGGGTCAGTGTTACTTCAGGAACGGCACCGACAATGTCAGGCTTCTGGAGCGCTACATTTATAATCAGGAGGAGTACGCCTACTTTGACAGTGATGTGGGTTTGTTTATCGCTAAAACCGAGCTGGGGAAACCGAGTGCGGATTATTGGAACAGCCAGAAGGATTTCCTAGAACAGGAACGGGCTGCGGTGGATACAGTCTGCAGACCCAACTATCAGATCTTTAAACCCACTGCTATAGACAGGAAATCTCAACCGAATGTAAAGATTGTAAACACAAAGACACTGGATTTGGAACATGAAAACCTTATAACCTGTTTGGTAGATGGGTTCTTTCCTCCTACGATAAAGGTGACTTGACTGAGGAATGGGATTGAAGAGGGAGAGCAAGTCACATCCTCACAATTATTACAGAATGGAGACTGGACATTTGAAATCCATATGAAGCTGGGAAAAACCAATTAAACATGGTGACACGTTTAACTGCCAGGGGGAGGCGGGCAAACTGCAAGATACTTGTAAATGTAAACTGGGAAGCCAGAAAGAATCTATTCTGCTCGCCAAGAGAGAGTGAGCGGGGGTGTGGGGGTGGGGGGTGGGGGAGGCGGTTTGAACATGGTTGACCTGTGGGGGGGAAAGGAGGAAGATAAAAAGAGAA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGGGGTATCAGTGCGAGTTGTGTCCGTACTACTGACCCTCAGTGTGTGTCTCTGTTCCTCACCCCCAGAGGATTACGTGTATCAGGTGAAGGGTCAGTGTTACTTCAGGAACGGCACCGACAATGTCAGGCTTCTGGAGCGCTACATTTATAATCAGGAGGAGTACGCCTACTTTGACAGTGATGTGGGTTTGTTTATCGCTAAAACCGAGCTGGGGAAACCGAGTGCGGATTATTGGAACAGCCAGAAGGATTTCCTAGAACAGGAACGGGCTGCGGTGGATACAGTCTGCAGACCCAACTATCAGATCTTTAAACCCACTGCTATAGACAGGAAATCTCAACCGAATGTAAAGATTGTAAACACAAAGACACTGGATTTGGAACATGAAAACCTTATAACCTGTTTGGTAGATGGGTTCTTTCCTCCTACGATAAAGGTGACTTGACTGAGGAATGGGATTGAAGAGGGAGAGCAAGTCACATCCTCACAATTATTACAGAATGGAGACTGGACATTTGAAATCCATATGAAGCTGGGAAAAACCAATTAAACATGGTGACACGTTTAACTGCCAGGGGGAGGCGGGCAAACTGCAAGATACTTGTAAATGTAAACTGGGAAGCCAGAAAGAATCTATTCTGCTCGCCAAGAGAGAGTGAGCGGGGGTGTGGGGGTGGGGGGTGGGGGAGGCGGTTTGAACATGGTTGACCTGTGGGGGGGAAAGGAGGAAGATAAAAAGAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGGGGTATCAGTGCGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838702
dbEST ID: 79656404
Trimmed Sequence: TCTCATTAGATTTTCATTCTGTACCACTGAAAAGCGAGTCATAGTCTTCTTACTCCGGAGGTAGACTACAAGGCCGACAATGATGAAAATGGATCCAAGCACAAACCCAACAATACCAGTCAGCATCTTATTGCGAGCAGAATCAGATACATCTGGCTCCCAGTTTACATATACAGGTTGTTGCAGGCTGCTGTGCTCCACCCGGCAGGTGAAAGTGTCACCATGTTTAATGGTTGTCTCCAGCATCATATGGATTTCAAATGTCCAGTCTCCATTCTGTAATAACTCTGAGGATGTGACCTGTTCTCCCTCTTCAATCCCATTCTTCAGCCAAGTCACCTTTATCGTAGGAGGAAAGAACCCATCTACCAAACAGGTTATAAGGTTTTCATGTTCCAAATCCAGTGTCTTTGTGTTTACAATCTTTACATTCGGTTGAGATTTCCTGTCTATAGCAGTGGGTTTAAAGATCTGATAGTTGGGTCTGCAGACTGTATCCGCCGCAGCCCGTTCCTGTTCTAGAAATCCTTCTGGCTGTTCGCATAATCCGCACTCGGTTTCGCCAGCTTCGGTTTTACCGATAAACGAACCCACATCACTTTCAAAGTAAGCGTAACTCCTCCCGGATAATAGTGGTGGGGCTCCGGAAACCTGAAAATTTCAGGTGCCCTTTCCGGGGGTAAAGTGGAACCCTTTACCGTAATACCAGTAATCCTACTGGGGGGGTTAAAGAGCGGGGGGAAACACCCCGTTGGGGGGCCCGGGT
Full Trace Sequence: GGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTCATTAGATTTTCATTCTGTACCACTGAAAAGCGAGTCATAGTCTTCTTACTCCGGAGGTAGACTACAAGGCCGACAATGATGAAAATGGATCCAAGCACAAACCCAACAATACCAGTCAGCATCTTATTGCGAGCAGAATCAGATACATCTGGCTCCCAGTTTACATATACAGGTTGTTGCAGGCTGCTGTGCTCCACCCGGCAGGTGAAAGTGTCACCATGTTTAATGGTTGTCTCCAGCATCATATGGATTTCAAATGTCCAGTCTCCATTCTGTAATAACTCTGAGGATGTGACCTGTTCTCCCTCTTCAATCCCATTCTTCAGCCAAGTCACCTTTATCGTAGGAGGAAAGAACCCATCTACCAAACAGGTTATAAGGTTTTCATGTTCCAAATCCAGTGTCTTTGTGTTTACAATCTTTACATTCGGTTGAGATTTCCTGTCTATAGCAGTGGGTTTAAAGATCTGATAGTTGGGTCTGCAGACTGTATCCGCCGCAGCCCGTTCCTGTTCTAGAAATCCTTCTGGCTGTTCGCATAATCCGCACTCGGTTTCGCCAGCTTCGGTTTTACCGATAAACGAACCCACATCACTTTCAAAGTAAGCGTAACTCCTCCCGGATAATAGTGGTGGGGCTCCGGAAACCTGAAAATTTCAGGTGCCCTTTCCGGGGGTAAAGTGGAACCCTTTACCGTAATACCAGTAATCCTACTGGGGGGGTTAAAGAGCGGGGGGAAACACCCCGTTGGGGGGCCCGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTCATTAGATTTTCATTCTGT