ORFeome > LOC100049121 ORF1 – XORFeome v1.0

LOC100049121 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255223
Gene Page ID:
ORF Xenbase ID: 17254803

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC133811
Original XGC clone length: 297

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ840223
dbEST ID: 79657925
Trimmed Sequence: ATGATGTGCGGCGGCACCGGGAAACAGAGGGCGGCGGATACGGAAGTGCAGGAAATCTGTGAGAAGGTGAAGGCGGAGTTTGTGCAGAAGTCTGGGGTCAATTCGTCAGTGTTTGAAGCCGTCTCCTACAAAACTCAAGTAGTGGCCGGGACCAATTACTTTATTAAGGCTCACATTGGAGGGAACAAGTGTGCCCACCTGCGTGTGTATAAGCGACTGCCCCACCAGCAGGAGGTGCTCAGTCTCGACTCATTCCTACTGGACAAGACTATGGAGGAGGAGATTGTTTATTTCTT
Full Trace Sequence: GGGGGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGTGCGGCGGCACCGGGAAACAGAGGGCGGCGGATACGGAAGTGCAGGAAATCTGTGAGAAGGTGAAGGCGGAGTTTGTGCAGAAGTCTGGGGTCAATTCGTCAGTGTTTGAAGCCGTCTCCTACAAAACTCAAGTAGTGGCCGGGACCAATTACTTTATTAAGGCTCACATTGGAGGGAACAAGTGTGCCCACCTGCGTGTGTATAAGCGACTGCCCCACCAGCAGGAGGTGCTCAGTCTCGACTCATTCCTACTGGACAAGACTATGGAGGAGGAGATTGTTTATTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGTCCGACCGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCACGTGTCTCAAAATCTCTAATGTTACATAATGGAACTGCCGGGGAGAAATAAAAAAAAAGAAATAAAAAAAAAAGAAGGGAGCCGGTTCCCAAAAAAACAAGTCCCGGAATAAAAAAAAAAAAAATCAGAACCAACCCCCAAAGGTTGGAAAAGATATACCGAAAAAAAAAAAAAGAGGGTAGAAGAAAAAAAGGAGACGGGGGGACCCCCCCCCCCAGGGGAGAGAAAAGAGAGGTTTGATTCTAAATGTTTTTTTCTGTTTCTTCGGGGGTTTTTGGTTGGTTTTAAAACATATTGGGAGGGGAGAGACCGGGGGGGGGGGGGCGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTGCGGCGGCACC

Sequences - 3ʹ (reverse) EST

Accession: JZ840222
dbEST ID: 79657924
Trimmed Sequence: GAAATAAACAATCTCCTCCTCCATAGTCTTGTCCAGTAGGAATGAGTCGAGACTGAGCACCTCCTGCTGGTGGGGCAGTCGCTTATACACACGCAGGTGGGCACACTTGTTCCCTCCAATGTGAGCCTTAATAAAGTAATTGGTCCCGGCCACTACTTGAGTTTTGTAGGAGACGGCTTCAAACACTGACGAATTGACCCCAAACTTCTGCACAAACTCCGCCTTCACCTTCTCACAGATTTCCTGCACTTCCGTATCCNCCGCCCTCTGTTTCCCGGTGCCGCCGCACATCATGG
Full Trace Sequence: GACGGGAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAATAAACAATCTCCTCCTCCATAGTCTTGTCCAGTAGGAATGAGTCGAGACTGAGCACCTCCTGCTGGTGGGGCAGTCGCTTATACACACGCAGGTGGGCACACTTGTTCCCTCCAATGTGAGCCTTAATAAAGTAATTGGTCCCGGCCACTACTTGAGTTTTGTAGGAGACGGCTTCAAACACTGACGAATTGACCCCAAACTTCTGCACAAACTCCGCCTTCACCTTCTCACAGATTTCCTGCACTTCCGTATCCNCCGCCCTCTGTTTCCCGGTGCCGCCGCACATCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGACCGTCGTTTTACAACTCATAACTGGGATATTACTTACCAGCTCTGGCGCATTTAATGGGACCACTAGAATTACATGGCTCCNGNNNCAAAAAAATCGGCCGGTAGAAAACAATAATCAGAAAGTCAACCAGAAAAAAGTAAGACACTGTCTCGGAAAACAAAGTCAGCGTGGACGCGACCGATGAGTGGGGGGAAAGCANGNACAGGGCGGGGCGAAAGGAGGTTAGATTTAAAGGGGNAAGCGCCGGTTCGAGGGAGGGGGTNNTGTTGTTTATATAATTTGGAGGGGGGGGGGGGGGGGGGGAGGGGAACAACACCCNCTTCTTAAAAAAGAAAAAGAGAGGAGTGATAGTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAATAAACAATCTCCTCCTCCA