ORFeome > LOC100049150 ORF1 – XORFeome v1.0

LOC100049150 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255212
Gene Page ID:
ORF Xenbase ID: 17254833

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC139490
Original XGC clone length: 372

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ838593
dbEST ID: 79656295
Trimmed Sequence: ATGGCTGTCCCTGCTGTGCATGATGCTGGAGCACTTATAACATTCATCTGTGGTGTGCTGTATATTTTATTACAGTCATTTATCTCCTACAAGTCCTGCCCTACTTGGAACTCAAGATTCACATGTCATATAAGAATGGCCATTTCTGTGATAGCATTTATTGCTGTGGTACCCATGAGTGTTTTTTCTGTGTTAGGTGGAAGAAAAAGGCTTGATTGGAAACCAAGTGATGAGGGATATCCCTATCACCTAACAAGTGCTATCTGTGAATGGACAGTGGCATTTGGATTTAATATGTATTTCCTTACATTCATCAAAGATTTTCAGGGTGTAAGTATACACATTTCAACAGAAATACATGAAGACTTTTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGTCCCTGCTGTGCATGATGCTGGAGCACTTATAACATTCATCTGTGGTGTGCTGTATATTTTATTACAGTCATTTATCTCCTACAAGTCCTGCCCTACTTGGAACTCAAGATTCACATGTCATATAAGAATGGCCATTTCTGTGATAGCATTTATTGCTGTGGTACCCATGAGTGTTTTTTCTGTGTTAGGTGGAAGAAAAAGGCTTGATTGGAAACCAAGTGATGAGGGATATCCCTATCACCTAACAAGTGCTATCTGTGAATGGACAGTGGCATTTGGATTTAATATGTATTTCCTTACATTCATCAAAGATTTTCAGGGTGTAAGTATACACATTTCAACAGAAATACATGAAGACTTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAAAAATAAAAAAAAAAAAAAATCTCTAATGTTACACCNNNNTCTGNNGNGGNNTNGTTTCCCCGTCCTTTTCGCGTCTAAAAAAAAAAGAAATTTGATAAAAGAAGATGAAGGAACAGACAATGCAGAAGAAGGAGGGANGTATTAGTGGGGTTGTATCGTAGGACTACCCTTTGTGTGGTGTATAGATTGTATCTGGGTGAACACTAATTGGTGGCGGTTGGTATTATGTTATATATATTTTTTTATTTTGTCAGGTAGTGAAAATGAGTCAGGATGTCCN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGTCCCTGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838592
dbEST ID: 79656294
Trimmed Sequence: AAAGTCTTCATGTATTTCTGTTGAAATGTGTATACTTACACCCTGAAAATCTCTGATGAATGTAAGGAAATACATATTAAATCCAAATGCCACTGTCCATTCACAGATAGCACTTGTTAGGTGATAGGGATATCCCTCATCACTTGGTTTCCAATCAAGCCTTTTTCTTCCACCTAACACAGAAAAAACACTCATGGGTACCACAGCAATAAATGCTATCACAGAAATGGCCATTCTTATATGACATGTGAATCTTGAGTTCCAAGTAGGGCAGGACTTGTAGGAGATAAATGACTGTAATAAAATATACAGCACACCACAGATGAATGTTATAAGTGCTCCAGCATCATGCACAGCAGGGACAGCCATGG
Full Trace Sequence: GGTAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTCTTCATGTATTTCTGTTGAAATGTGTATACTTACACCCTGAAAATCTCTGATGAATGTAAGGAAATACATATTAAATCCAAATGCCACTGTCCATTCACAGATAGCACTTGTTAGGTGATAGGGATATCCCTCATCACTTGGTTTCCAATCAAGCCTTTTTCTTCCACCTAACACAGAAAAAACACTCATGGGTACCACAGCAATAAATGCTATCACAGAAATGGCCATTCTTATATGACATGTGAATCTTGAGTTCCAAGTAGGGCAGGACTTGTAGGAGATAAATGACTGTAATAAAATATACAGCACACCACAGATGAATGTTATAAGTGCTCCAGCATCATGCACAGCAGGGACAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAAACTTAGGAAAAAAAAAAAAAAAAAAAAAACATAAACAAAAAAAAAACCGACCCGCCACAAAGAAAAAAAACCACATCCGACAAAACAAAAAAACTCTGTTTTGACCACAGCAGAAAGAAAGAAGCNGAAAGAAAAAGAGTAATANAGGGTGTGTGTGTGGGTGAAGGAAAAGAGAAAAAAAGNNTGGCCCANGAGGGGGGAGGAGAGATGGGGGAGGGGTGGGGGGGGGGGGGGGGGGGGGGGAGGANGGGGAGGAGGAAAGAGGAGAGAGGNAAGNGNNNGAAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTCTTCATGTATTTCTGT