ORFeome > LOC100049749 ORF1 – XORFeome v1.0

LOC100049749 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256291
Gene Page ID:
ORF Xenbase ID: 17254845

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141720
Original XGC clone length: 465

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ838868
dbEST ID: 79656570
Trimmed Sequence: ATGAGTTGGTGTTTGAGCAAAGTTTCCGCAGCTCTCCTGCGAGGAAGCGTTCGGACTCAGCAGGCCTGTGGTTCCTTATCCACCCGGCGATGGATTAGTTCAGACAGCCGATCCCCGGAGCACTTAGACGGGTTGATTAAGAAAGACAAAGTAGTGGTGTTCATCAAGGGCACCCCGGCCCAGCCTATGTGCGGCTTTAGCAACGCGGTGGTGCATATACTCCGTATGCATGGCGTGCACGAATACGCGGCCTATAATGTACTGTAAGACCATGACCTGATGACAGGGATAAAGAATTATTCTAACTGGCCCACCATACCTCAGGTCTATTTTAATGGAGAACTGGTGGGGGGCTGTGATAACCTACTTCAATTGCATCTTAAAGGAGACCTTGTGTAAATAGCTGAATAATTTGTGAATTCTTTCTGCTTTGTTATATGTAGAACCTAGTCAGTATATAATATGCCATTTTTCTTTGTTAATGTTGGTGCATATAAGAATGCTTGGCTTACTATTAGTTGCTTTGTAATTGTTTTTTTTCATTCCAATTATAATTTTTCGTTTGTTATTCATGGGATAACTCTCTATTATTTATGTTACATTCCTTGTTCTATATTTGTAATTTTGGTATGATTCTGTGCCCTTCTTATTTATTTTTATATGTTTTTATAAATACTTTACTTATTACATTTTTATATTACTCTCTTCTATATGTATAATTATCTCAATATTATCAATAATATGTTTCTCTTTAAATTCATTTGTAACTCTTAGATTTCTAC
Full Trace Sequence: GAGGGGGAATATGCGCTGGAAAAGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTGGTGTTTGAGCAAAGTTTCCGCAGCTCTCCTGCGAGGAAGCGTTCGGACTCAGCAGGCCTGTGGTTCCTTATCCACCCGGCGATGGATTAGTTCAGACAGCCGATCCCCGGAGCACTTAGACGGGTTGATTAAGAAAGACAAAGTAGTGGTGTTCATCAAGGGCACCCCGGCCCAGCCTATGTGCGGCTTTAGCAACGCGGTGGTGCATATACTCCGTATGCATGGCGTGCACGAATACGCGGCCTATAATGTACTGTAAGACCATGACCTGATGACAGGGATAAAGAATTATTCTAACTGGCCCACCATACCTCAGGTCTATTTTAATGGAGAACTGGTGGGGGGCTGTGATAACCTACTTCAATTGCATCTTAAAGGAGACCTTGTGTAAATAGCTGAATAATTTGTGAATTCTTTCTGCTTTGTTATATGTAGAACCTAGTCAGTATATAATATGCCATTTTTCTTTGTTAATGTTGGTGCATATAAGAATGCTTGGCTTACTATTAGTTGCTTTGTAATTGTTTTTTTTCATTCCAATTATAATTTTTCGTTTGTTATTCATGGGATAACTCTCTATTATTTATGTTACATTCCTTGTTCTATATTTGTAATTTTGGTATGATTCTGTGCCCTTCTTATTTATTTTTATATGTTTTTATAAATACTTTACTTATTACATTTTTATATTACTCTCTTCTATATGTATAATTATCTCAATATTATCAATAATATGTTTCTCTTTAAATTCATTTGTAACTCTTAGATTTCTAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTGGTGTTTGAGCAAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838867
dbEST ID: 79656569
Trimmed Sequence: CTTTTTCTCTTGGCTTGGTTCAGCATCTAACAATGCAGAACGAATTCCCAACTTATTCAGCTCTTCCACAAGGTCTCCATTCTGATGCATTTGAAGTAGGATATCACAGCCCCCCACAAATTCACCATTAAAGTAGACCTGAGGTATGGTGGGCCAGTTTGAATAATTCTTTATCCCTGTCCTCATGTCCTGGTCTTCCACTACATTATAGGCCGCGTATTCGTGCACGCCATGCATACGGAGTATTTGCACCACCGCGTTGCTAAAGCCGCACATAAGCTGGGCCGGGGTGCCCTTGATGAACACCACTACTTTCTCTTTCTTAATCAACCCGCCTAACTGCTCCCGGGATCGACTGTCTGAACTAATCCAATCTTCTGTTGGATAAGTAACCACACGCCAGCTCATTACCAACACTCCCTCCCAAGATATCTGCGGATACTTTGCTCAAATTCAATTTATGGCTGCTACTTTATTATACAAAGTTGAATTAATAAACAGCAATACTTTATATTTTTTCTCCACAAATACGCCCACACCTCTTCAAAAACAACTCATTATTTGGGGTCCCAATCTTAATAAAGCCCAACAAAATTACAATTCCATGATCTAGGAAAATTTACATTAAAAACCCTAATTGTCCATAAAAGTTTTAATTCTGTCTACTATTTCCTTATTCTATAACTTTCATCAAAAAAAAAAAAAAAAAACCGAAAATGCAACATTCATCAAATAAAATCATCAAAATTGATACCTTTAACATCGATACCTCATTN
Full Trace Sequence: AAAACTGCTATCGACCATGTAATACGACTCACTATANGGGGATATCAGTCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTCTCTTGGCTTGGTTCAGCATCTAACAATGCAGAACGAATTCCCAACTTATTCAGCTCTTCCACAAGGTCTCCATTCTGATGCATTTGAAGTAGGATATCACAGCCCCCCACAAATTCACCATTAAAGTAGACCTGAGGTATGGTGGGCCAGTTTGAATAATTCTTTATCCCTGTCCTCATGTCCTGGTCTTCCACTACATTATAGGCCGCGTATTCGTGCACGCCATGCATACGGAGTATTTGCACCACCGCGTTGCTAAAGCCGCACATAAGCTGGGCCGGGGTGCCCTTGATGAACACCACTACTTTCTCTTTCTTAATCAACCCGCCTAACTGCTCCCGGGATCGACTGTCTGAACTAATCCAATCTTCTGTTGGATAAGTAACCACACGCCAGCTCATTACCAACACTCCCTCCCAAGATATCTGCGGATACTTTGCTCAAATTCAATTTATGGCTGCTACTTTATTATACAAAGTTGAATTAATAAACAGCAATACTTTATATTTTTTCTCCACAAATACGCCCACACCTCTTCAAAAACAACTCATTATTTGGGGTCCCAATCTTAATAAAGCCCAACAAAATTACAATTCCATGATCTAGGAAAATTTACATTAAAAACCCTAATTGTCCATAAAAGTTTTAATTCTGTCTACTATTTCCTTATTCTATAACTTTCATCAAAAAAAAAAAAAAAAAACCGAAAATGCAACATTCATCAAATAAAATCATCAAAATTGATACCTTTAACATCGATACCTCATTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTCTCTTGGCTTGGTTC