ORFeome > LOC100049750 ORF1 – XORFeome v1.0

LOC100049750 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5896279
Gene Page ID: 5895996
ORF Xenbase ID: 17254851

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141737
Original XGC clone length: 975

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ838884
dbEST ID: 79656586
Trimmed Sequence: ATGGAACTGGGTCCGGCATCCTGCGTTACTCTGAATGATGGGCACAAGATGCCAGTCCTTGGATTTGGCACCTATGCTCCAGATAAGATTGACAAATCCCTGGCAGAAGAGGCTACTAAAGTGGCCATAGAGGTTGGATTTCGCCACATCGACTGTGCCCATTTCTATGGCAACGAGGCGGAGGTCGGACGAGCCATAAAGATGAAGATGGAGGATGGGACGGTGAGGAGAGAAGAACTGTTCTACACTGGCAAGTTGTGGAACACGTATCACGACCCTGAACTGGTCCAGCCTGCGCTAGAGAAATCCCTGCAGGACCTTCAGCTTCATTACATGGATCTGTTTGTGATACACATGCCTATGGGACTGAAGCCAGGGGAAGATCTCATTCCGAGAGACGAGAAGGGGCACTTTATTTATCTGAAAGTTGAGTCTGCGTCGCACTTGAGAGGCGGGGGAAAAATGGAAATACGCAGGGGCTGGTCGAATCCATTGGAGGTCTCCGAGATTTAACGAGGGGGAGCTGGAAGGATGATCGTGGAGAGGCAATGGCCGTGGAGTAAATACCTTCTGTGTGACCCAGGTTTGAATGGAGGTGCATTCCTTAAGTGGCGAAGAAGATAGTCTGAGGTGTGTGTCGTGCCACGCCTAAGAATGAGTGTAGGTGAGTAGGGTGTTATGACATTATAGTAGGGGGAGTGTGAGAGAAAAATGAGAAGAAACAAGTGAAAAGGGAAAACAGTTGATCTGGGTGGTAATTAGGGGGAGATTAACACGTATATAGGTGTTAGAAAATTATAACAGACACTATAATTTACAAGTAAAAACCTCTCTGCAATCACCACA
Full Trace Sequence: TCGGGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACTGGGTCCGGCATCCTGCGTTACTCTGAATGATGGGCACAAGATGCCAGTCCTTGGATTTGGCACCTATGCTCCAGATAAGATTGACAAATCCCTGGCAGAAGAGGCTACTAAAGTGGCCATAGAGGTTGGATTTCGCCACATCGACTGTGCCCATTTCTATGGCAACGAGGCGGAGGTCGGACGAGCCATAAAGATGAAGATGGAGGATGGGACGGTGAGGAGAGAAGAACTGTTCTACACTGGCAAGTTGTGGAACACGTATCACGACCCTGAACTGGTCCAGCCTGCGCTAGAGAAATCCCTGCAGGACCTTCAGCTTCATTACATGGATCTGTTTGTGATACACATGCCTATGGGACTGAAGCCAGGGGAAGATCTCATTCCGAGAGACGAGAAGGGGCACTTTATTTATCTGAAAGTTGAGTCTGCGTCGCACTTGAGAGGCGGGGGAAAAATGGAAATACGCAGGGGCTGGTCGAATCCATTGGAGGTCTCCGAGATTTAACGAGGGGGAGCTGGAAGGATGATCGTGGAGAGGCAATGGCCGTGGAGTAAATACCTTCTGTGTGACCCAGGTTTGAATGGAGGTGCATTCCTTAAGTGGCGAAGAAGATAGTCTGAGGTGTGTGTCGTGCCACGCCTAAGAATGAGTGTAGGTGAGTAGGGTGTTATGACATTATAGTAGGGGGAGTGTGAGAGAAAAATGAGAAGAAACAAGTGAAAAGGGAAAACAGTTGATCTGGGTGGTAATTAGGGGGAGATTAACACGTATATAGGTGTTAGAAAATTATAACAGACACTATAATTTACAAGTAAAAACCTCTCTGCAATCACCACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACTGGGTCCGGCATCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838883
dbEST ID: 79656585
Trimmed Sequence: ATATTCATCATGGAAAGGATACTGGGGATGGTCCCTCCATACTTTAGCCTCAACATAACGCATGTTCCTATTGAGTCCTCCCAGTTCTTTCATGTCTTCTTCTGGGAGATGGAAATCAAATACCTGGAAGTTTTCTTTGATCCTCTCTGGGTTTGAGCTCTTTGCCAGCACCACGACACCCTGTTGTAGGAGATATCTCAGTGCAACTTGTGCCGGGGATTTATTTTGTCTCCTCGCTATGGCGTTCAGCACAGGATCCTCCAGGAGAACCGGCAAGTTCTGGTCTATCCATTTCTCATCTCTGCTGGACCCCAGAATACCGTATCCCACCAACACTATCTCCTGGGACTGGCAGAACCCCAGCAGTTTGCTCTGGTTCAGGTATAGGTGGCATTCAACCTGGTTACACACAGGTTTGTATTTCAAGCCAGGCTTGTTCAGGATCAGCTCCAGCTGCCGGCGGTTAAAGTTGGAGACCCACATGGATCTGACCAGCCCTGCGTCTTTGCATTTCTCCATTGCCTCCCCAATGTGACGCAGATCAACATATATAAAAAATAAATGCCCCCCTCTCCTCCCTCCGAAATGAAATCTTCCCCTGGCCTTCAGCCCCTAAGGCCTGTTTTTAAAAAAACAAATACCATGTAATGAAATCTAAAAAGTCCCTGCCGGGGATTTCCTCTGGCCCATGGCGGGACCGAATTTCAGGGGTCCGTGGTAAAGGGTTTCCCGCAAACTTTGCCGATGGTAAAAAAAAGAGTTTCCTTCTCCTTCCCCTCT
Full Trace Sequence: CGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATATTCATCATGGAAAGGATACTGGGGATGGTCCCTCCATACTTTAGCCTCAACATAACGCATGTTCCTATTGAGTCCTCCCAGTTCTTTCATGTCTTCTTCTGGGAGATGGAAATCAAATACCTGGAAGTTTTCTTTGATCCTCTCTGGGTTTGAGCTCTTTGCCAGCACCACGACACCCTGTTGTAGGAGATATCTCAGTGCAACTTGTGCCGGGGATTTATTTTGTCTCCTCGCTATGGCGTTCAGCACAGGATCCTCCAGGAGAACCGGCAAGTTCTGGTCTATCCATTTCTCATCTCTGCTGGACCCCAGAATACCGTATCCCACCAACACTATCTCCTGGGACTGGCAGAACCCCAGCAGTTTGCTCTGGTTCAGGTATAGGTGGCATTCAACCTGGTTACACACAGGTTTGTATTTCAAGCCAGGCTTGTTCAGGATCAGCTCCAGCTGCCGGCGGTTAAAGTTGGAGACCCACATGGATCTGACCAGCCCTGCGTCTTTGCATTTCTCCATTGCCTCCCCAATGTGACGCAGATCAACATATATAAAAAATAAATGCCCCCCTCTCCTCCCTCCGAAATGAAATCTTCCCCTGGCCTTCAGCCCCTAAGGCCTGTTTTTAAAAAAACAAATACCATGTAATGAAATCTAAAAAGTCCCTGCCGGGGATTTCCTCTGGCCCATGGCGGGACCGAATTTCAGGGGTCCGTGGTAAAGGGTTTCCCGCAAACTTTGCCGATGGTAAAAAAAAGAGTTTCCTTCTCCTTCCCCTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATTCATCATGGAAAGGATACTG