ORFeome > LOC100049763 ORF1 – XORFeome v1.0

LOC100049763 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253936
Gene Page ID:
ORF Xenbase ID: 17254857

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141756
Original XGC clone length: 963

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ838882
dbEST ID: 79656584
Trimmed Sequence: ATGACTTCTGGAAAGGCTTCTAAGGAGTTGCTCCAAATGGATCTGTATGGGCTGCTGGGAGTGGGGCCGCATGCAACAGGAAAACAGATTAAGAAAGCATACAGACAGAAAGCGCTAACTTGCCATCCAGACAAGAATCCAGACAACCCTCGGGCAGCTGAACTGTTTCACCAGCTGTCTCAGGCCTTGGAAGTGTTGACTGATGGTGCAGCCAAGGTAGCATATGACAATCTCCGGAAAGCTAAAGAGGCTGCTGCAAAAAGAACCCAAAATCTAGATGAGAAGAGAAAGAAAGTAAAGCTTGACTTAGAGGCACGTGAGCGGGAGGCACAGACTCGGGTGACAGAAGAAGATAAAGCACAAGTTGCACGAACATTAAAACAAGAGATCATACGCCTCCTGGAAGAAGAATCAAGGCAGCTGGAGGAGCAACAGAGGCAGGTACAGGAACAGATCAAAGCAGAGATGACACAGAGGCTGCAAGGTCAAAGTGCTAGTGATGCTGTATATGGGACACTGTCTGCTAAACTCAAGCTAAAATGGAAATACAAAAAGGATGATGAGACAAAAGGCGGCTATGCAGAAGATGTACCTAGGATGCTCCTTCAAAAGTATGGCCAAGTAAACATTTACCCATTTCCTCGAGAAAGGAAAGGCCATAGCAGAATTATTAATCATTAAAACGTGCGAAAAGTGCCATGAGAAAGGAAAGCGGGCCTTTTAAATTTTTCTTCCTAACCTCCTCCCTGTTTTGGGTAAGCTGCGCCCCGTTTGCCCTGCTCCCAGATAAAGATTCGCAG
Full Trace Sequence: TCGAGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCTGGAAAGGCTTCTAAGGAGTTGCTCCAAATGGATCTGTATGGGCTGCTGGGAGTGGGGCCGCATGCAACAGGAAAACAGATTAAGAAAGCATACAGACAGAAAGCGCTAACTTGCCATCCAGACAAGAATCCAGACAACCCTCGGGCAGCTGAACTGTTTCACCAGCTGTCTCAGGCCTTGGAAGTGTTGACTGATGGTGCAGCCAAGGTAGCATATGACAATCTCCGGAAAGCTAAAGAGGCTGCTGCAAAAAGAACCCAAAATCTAGATGAGAAGAGAAAGAAAGTAAAGCTTGACTTAGAGGCACGTGAGCGGGAGGCACAGACTCGGGTGACAGAAGAAGATAAAGCACAAGTTGCACGAACATTAAAACAAGAGATCATACGCCTCCTGGAAGAAGAATCAAGGCAGCTGGAGGAGCAACAGAGGCAGGTACAGGAACAGATCAAAGCAGAGATGACACAGAGGCTGCAAGGTCAAAGTGCTAGTGATGCTGTATATGGGACACTGTCTGCTAAACTCAAGCTAAAATGGAAATACAAAAAGGATGATGAGACAAAAGGCGGCTATGCAGAAGATGTACCTAGGATGCTCCTTCAAAAGTATGGCCAAGTAAACATTTACCCATTTCCTCGAGAAAGGAAAGGCCATAGCAGAATTATTAATCATTAAAACGTGCGAAAAGTGCCATGAGAAAGGAAAGCGGGCCTTTTAAATTTTTCTTCCTAACCTCCTCCCTGTTTTGGGTAAGCTGCGCCCCGTTTGCCCTGCTCCCAGATAAAGATTCGCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCTGGAAAGGCTTCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ838881
dbEST ID: 79656583
Trimmed Sequence: TGTGGCGCTGTAATAAACACTGAAGCATGCAGTAATTACAGGGCTCCTTTTGCTTCCTGCAGCTGCTCTGCTCCGAGATTGGCCCAGCAGTTTGGGAAGCAACACGGACCTGGCATACAGAAAAACCTTTGGCACCTGGGAGGGTACAGAATGTGTACTGACATATGACCAACTGCAATTCTCCTGGACAGTGGAAGGAGGAGGGGTACCCAACCAGGAGAGTGTTAGAGGGTTACTTAAAAGGCCGGATTCGTTTCTCACTGCCATTTCGGCAGCTTTAAATGATGAAAACTCTGCTATGGCAGTTCCTTTCTTGCTGGAGATGAGTAAATGTGTAACTTGCCCATACTTCTGAAGGAGCATCCTAAGTACATCTTCTGTATAGCCGCCTCTTGTCTCATCATCCTTTTTGTATTTCCATTTTAGCTTGAGTTTAGCAGACAGTGTCCCATCTACAGCATCACTAGCACTTTGACCTTGCAGCCTCTGTGTCATCTCTGCTTTGATCTGTTCCTGTACCTGCCTCTGTTGCTCCTCCAGCTGCCTTGATTCTTCTTCCAGGAGGCGTATGATCTCTTGTTTTAATGTTCGTGCAACTTGTGCTTTATCTTCTTCTGTCACCCGAGTCTGTGCCTCCCGCTCACGTGCCTCTAAGTCAAGCCTTTACTTTCTTTCCCTCCCATTCTAAATTTTGGGGGTCTTTTTTGCACCAACCTCCTTTAGCCTTTCCCGAAAATTGGCAAAAATCTACCTTTGCCTTGCCCCCATCCCCTC
Full Trace Sequence: ACGCAGTGGGTAATACGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTGGCGCTGTAATAAACACTGAAGCATGCAGTAATTACAGGGCTCCTTTTGCTTCCTGCAGCTGCTCTGCTCCGAGATTGGCCCAGCAGTTTGGGAAGCAACACGGACCTGGCATACAGAAAAACCTTTGGCACCTGGGAGGGTACAGAATGTGTACTGACATATGACCAACTGCAATTCTCCTGGACAGTGGAAGGAGGAGGGGTACCCAACCAGGAGAGTGTTAGAGGGTTACTTAAAAGGCCGGATTCGTTTCTCACTGCCATTTCGGCAGCTTTAAATGATGAAAACTCTGCTATGGCAGTTCCTTTCTTGCTGGAGATGAGTAAATGTGTAACTTGCCCATACTTCTGAAGGAGCATCCTAAGTACATCTTCTGTATAGCCGCCTCTTGTCTCATCATCCTTTTTGTATTTCCATTTTAGCTTGAGTTTAGCAGACAGTGTCCCATCTACAGCATCACTAGCACTTTGACCTTGCAGCCTCTGTGTCATCTCTGCTTTGATCTGTTCCTGTACCTGCCTCTGTTGCTCCTCCAGCTGCCTTGATTCTTCTTCCAGGAGGCGTATGATCTCTTGTTTTAATGTTCGTGCAACTTGTGCTTTATCTTCTTCTGTCACCCGAGTCTGTGCCTCCCGCTCACGTGCCTCTAAGTCAAGCCTTTACTTTCTTTCCCTCCCATTCTAAATTTTGGGGGTCTTTTTTGCACCAACCTCCTTTAGCCTTTCCCGAAAATTGGCAAAAATCTACCTTTGCCTTGCCCCCATCCCCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGGCGCTGTAATAAACACT