ORFeome > LOC100049765 ORF1 – XORFeome v1.0

LOC100049765 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253934
Gene Page ID:
ORF Xenbase ID: 17254863

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141759
Original XGC clone length: 927

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ838896
dbEST ID: 79656598
Trimmed Sequence: ATGAGCCAATTTTGGGATTACAACCAGGCTATACTGGATGCACCACAGGAATTGTTCTACAGATTCCAACTGAACCCTGTTCATGGGGTCCCCATTATGAAGCCCATTGCAGATAACTGGGAGAGGATAGAGGCATTTCAGGCAAGGCCAGATGACCTCCTCGTTGCAACCTATCCCAAAGCAGGTACCACCTGGATGCAGGAAATAGTGGATTCCATCATTAACGATGGAGACCTGAAAAAAGTGAAATGTGCTCCTATGCACGTCCGATTCCCTTTCCTGGAAATCTGCAACCCTCCACCCGTCCCTTGTGGAGTAGATATCTTGGAAGGGACGACATCCCCACGAAAAATAAAAACTCATCTTCCTTATGAACTCATTCCAAGATCCTTCTGGGAACACGACTGCAAGGTGATCTATGTCGCCCGCAATGCAAAGGACTCTGCTGTCTCTTATTACCACTTTGATCTGATGGAAAAGACTCAACCACACCCCGGCACCCTGGAAGAGTATGTGGGAAAGTTCCTTAAAGGGAAATGTTCCCTGGGGCCGGCTGGTTTCAAATAATGTTA
Full Trace Sequence: GTCCCCACGGCGCAATATATATTTTTTTTAGCCGGGCCCAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCAATTTTGGGATTACAACCAGGCTATACTGGATGCACCACAGGAATTGTTCTACAGATTCCAACTGAACCCTGTTCATGGGGTCCCCATTATGAAGCCCATTGCAGATAACTGGGAGAGGATAGAGGCATTTCAGGCAAGGCCAGATGACCTCCTCGTTGCAACCTATCCCAAAGCAGGTACCACCTGGATGCAGGAAATAGTGGATTCCATCATTAACGATGGAGACCTGAAAAAAGTGAAATGTGCTCCTATGCACGTCCGATTCCCTTTCCTGGAAATCTGCAACCCTCCACCCGTCCCTTGTGGAGTAGATATCTTGGAAGGGACGACATCCCCACGAAAAATAAAAACTCATCTTCCTTATGAACTCATTCCAAGATCCTTCTGGGAACACGACTGCAAGGTGATCTATGTCGCCCGCAATGCAAAGGACTCTGCTGTCTCTTATTACCACTTTGATCTGATGGAAAAGACTCAACCACACCCCGGCACCCTGGAAGAGTATGTGGGAAAGTTCCTTAAAGGGAAATGTTCCCTGGGGCCGGCTGGTTTCAAATAATGTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCAATTTTGGGATTACAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838895
dbEST ID: 79656597
Trimmed Sequence: GATACTGAAACGGAATTTGAGGTCCGTTCCTTCCATTCTCTTCTGGTACTCGGCATCCAACATCTCATTCTGCTGAACAGTGAAATGATTCTTCCAGTCAGAGACTTCCCCTTTCCTCATGAATTTTGAGATGGACTGGTCCAAAACACTGGCTGGCGTGGTGCTGTAATTAGCCATGGGGTTTTCCTTCATGGCCTTGAAAGAGGTGTGCTGACAGATCTTCTCAAGAAGGTCCTCCGTTAAATCCTTCCCCAGGAACCTCATCACCTTGTGGATCTCACGCTTTGGGTCCTCTTTCATGTCCTCATAGAACATGTATAAGATTTGGTGTTTGGCCCTAGCTTTCCACCAGCCGATAACATGATCGAACCAGCCGCCCCAGGGCACATTTCCCTTTAAGAACTTTCCCACATACTCCTCCCAGGTGCCGGGGTGTGGCTGAGTCTTTTCCATCAGATCAAAGTGGTAATAAGAGACAGCAGAGTCCTTTGCATTGCGGGCGACATAGATCACCTTGCAGTCCTGTTCCCAAAAGGATCTTGGAATGAATTTCATAAGAAGATGAATTTTTTATTTTTCTTGGGGGAGGGCGTCCGTTTCCAGGAAATCTAACTCCAAAGGGGACCGGGTGGGGGGGTTGGGGGATTTCCCGGAGAAAAGGAAATCGGAAAGGGTCAATAAGGAAACCCATTTTCCACTTTTTTTTCGAGGGTTCCCCCTCCCCGTAATTGGAAATGGAAGATCG
Full Trace Sequence: GTGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATACTGAAACGGAATTTGAGGTCCGTTCCTTCCATTCTCTTCTGGTACTCGGCATCCAACATCTCATTCTGCTGAACAGTGAAATGATTCTTCCAGTCAGAGACTTCCCCTTTCCTCATGAATTTTGAGATGGACTGGTCCAAAACACTGGCTGGCGTGGTGCTGTAATTAGCCATGGGGTTTTCCTTCATGGCCTTGAAAGAGGTGTGCTGACAGATCTTCTCAAGAAGGTCCTCCGTTAAATCCTTCCCCAGGAACCTCATCACCTTGTGGATCTCACGCTTTGGGTCCTCTTTCATGTCCTCATAGAACATGTATAAGATTTGGTGTTTGGCCCTAGCTTTCCACCAGCCGATAACATGATCGAACCAGCCGCCCCAGGGCACATTTCCCTTTAAGAACTTTCCCACATACTCCTCCCAGGTGCCGGGGTGTGGCTGAGTCTTTTCCATCAGATCAAAGTGGTAATAAGAGACAGCAGAGTCCTTTGCATTGCGGGCGACATAGATCACCTTGCAGTCCTGTTCCCAAAAGGATCTTGGAATGAATTTCATAAGAAGATGAATTTTTTATTTTTCTTGGGGGAGGGCGTCCGTTTCCAGGAAATCTAACTCCAAAGGGGACCGGGTGGGGGGGTTGGGGGATTTCCCGGAGAAAAGGAAATCGGAAAGGGTCAATAAGGAAACCCATTTTCCACTTTTTTTTCGAGGGTTCCCCCTCCCCGTAATTGGAAATGGAAGATCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATACTGAAACGGAATTTGAGG