ORFeome > LOC100126624 ORF1 – XORFeome v1.0

LOC100126624 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5929438
Gene Page ID: 5929402
ORF Xenbase ID: 17254911

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC153811
Original XGC clone length: 912

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ839000
dbEST ID: 79656702
Trimmed Sequence: ATGGTCTACCTTGTTTTCTTGTGCCTTCTGCCCTCTCTAATTTCTGGAGCCAGCATCCTGCCCGAACCCAGGAAGGATGTCCGTGCTTCTGCTACAGATGCTGAAATTCAGAGTCTGGCTGAGCAGTTCTATGCAGCTGATACAAACAAGGCTGCTAGTGGGGACATAACCCTGAATCTGCAATACAAAGCCTCCAGCTCCCAGACTAGCACAGGAACTGACTATGCCAACCAAAAGTTATTTCGTTATGTGAATGAAGCCAAACTGTTTGCCCGCCCAACCTTTGCCCGGCTTGTGAATTTGCTTGATAATTATGCCCAGAAAACAGGAAGTGCAGAATCTGTGCCTACGACTGAAGTAAATGAGCAAAATGCTTTTCTAGACGAGATCTTCAAAACCTCAATCATCACCAAACTATCTAACTTCTTCATCTCTAAAGGGTACTACAGCTCAGCTGCCAGCTTTAAGACTGATCTTAAGGCTATNGTGGTTTGGTCTATACACCCGTACGAGTGGCCCCTTGGATTCTTCTGGATTTGAACATGTTTTCCATGGTGAAATCCACAAGGGAAAGGTATCAGGGCTTCACAACTGGGTGAAGCTCTATCTGCTGGAGAAATCTGGCCAAGTCAACTACCTGAGCTACAGCGCTGATGGAGTATGGAAAGGCTATCCAGATATTTATGCTTTTCAGTTGAAATGGAGTACTTACCTAAAACTATTGGATCTTTCCTTGTTGGCAATTAATCCTGGAGTTTGAAATTGCTATGTTAAACCTTTGGGTTAACTTTACCCCCCCCGGAAAAACCCGGGGGCCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCTACCTTGTTTTCTTGTGCCTTCTGCCCTCTCTAATTTCTGGAGCCAGCATCCTGCCCGAACCCAGGAAGGATGTCCGTGCTTCTGCTACAGATGCTGAAATTCAGAGTCTGGCTGAGCAGTTCTATGCAGCTGATACAAACAAGGCTGCTAGTGGGGACATAACCCTGAATCTGCAATACAAAGCCTCCAGCTCCCAGACTAGCACAGGAACTGACTATGCCAACCAAAAGTTATTTCGTTATGTGAATGAAGCCAAACTGTTTGCCCGCCCAACCTTTGCCCGGCTTGTGAATTTGCTTGATAATTATGCCCAGAAAACAGGAAGTGCAGAATCTGTGCCTACGACTGAAGTAAATGAGCAAAATGCTTTTCTAGACGAGATCTTCAAAACCTCAATCATCACCAAACTATCTAACTTCTTCATCTCTAAAGGGTACTACAGCTCAGCTGCCAGCTTTAAGACTGATCTTAAGGCTATNGTGGTTTGGTCTATACACCCGTACGAGTGGCCCCTTGGATTCTTCTGGATTTGAACATGTTTTCCATGGTGAAATCCACAAGGGAAAGGTATCAGGGCTTCACAACTGGGTGAAGCTCTATCTGCTGGAGAAATCTGGCCAAGTCAACTACCTGAGCTACAGCGCTGATGGAGTATGGAAAGGCTATCCAGATATTTATGCTTTTCAGTTGAAATGGAGTACTTACCTAAAACTATTGGATCTTTCCTTGTTGGCAATTAATCCTGGAGTTTGAAATTGCTATGTTAAACCTTTGGGTTAACTTTACCCCCCCCGGAAAAACCCGGGGGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCTACCTTGTTTTCTTGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838999
dbEST ID: 79656701
Trimmed Sequence: AATGGGGTAAGAAGAAGCCACGAATCTCTTTCCATTTCCATAGGTAGAGTTGGCCCAAGTGTAGGTTTGAATTTTGAAAATGGAGCCACCCATCTTTACTGAGCACAGGCTATCAGGGCGGGTAACGTAACACAAGGTGTACATAGCAATATCAAACTCAGGACTACTGCCAACAAAGAAAGATCCAATAGTTTTTAGGTAAGTACTCCATTTCAACTGAAAAGCATAAATATCTGGATAGCCTTTCCATACTCCATCAGCGCTGTAGCTCAGGTAGTTGACTTGGCCAGATTTCTCCAGCAGATAGAGCTTCACCCAGTTGTGAAGCCCTGATACCTTTCCCTTGTGGATTTCACCATGGAAAACATGTTCAAATCCAGAAGAATCCAAGGGGCCACTCGTACGGGTGTATAGACCAAACCACATAGCCTTAAGATCAGTCTTAAAGCTGGCAGCTGAGCTGTAGTACCCTTTAGAGATGAAGAAGTTAGATAGTTTGGTGATGATTGAGGTTTTGAAGATCTCGTCTAAAAAAGCATTTTGCTCATTTACTTCAGTCGTAGGCCCAGAATCCGCACTTTCCGGTTTCTGGGGCATAATTATCAAGCAAATTCACAAGCCAGGGCAAGGTTGGGCGGGGCAACCAGTTTGGCGTCCTTTAGATAACAAAAAATAAAATTTTAGGTGGGCAAAGGCGGGTCCCTGGTGCAATTCTGGGGGACGGGGAAGGCGTTGGGTTTTGGAAAAATTCAAGGGGTTATAGTCTC
Full Trace Sequence: GGGAAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATGGGGTAAGAAGAAGCCACGAATCTCTTTCCATTTCCATAGGTAGAGTTGGCCCAAGTGTAGGTTTGAATTTTGAAAATGGAGCCACCCATCTTTACTGAGCACAGGCTATCAGGGCGGGTAACGTAACACAAGGTGTACATAGCAATATCAAACTCAGGACTACTGCCAACAAAGAAAGATCCAATAGTTTTTAGGTAAGTACTCCATTTCAACTGAAAAGCATAAATATCTGGATAGCCTTTCCATACTCCATCAGCGCTGTAGCTCAGGTAGTTGACTTGGCCAGATTTCTCCAGCAGATAGAGCTTCACCCAGTTGTGAAGCCCTGATACCTTTCCCTTGTGGATTTCACCATGGAAAACATGTTCAAATCCAGAAGAATCCAAGGGGCCACTCGTACGGGTGTATAGACCAAACCACATAGCCTTAAGATCAGTCTTAAAGCTGGCAGCTGAGCTGTAGTACCCTTTAGAGATGAAGAAGTTAGATAGTTTGGTGATGATTGAGGTTTTGAAGATCTCGTCTAAAAAAGCATTTTGCTCATTTACTTCAGTCGTAGGCCCAGAATCCGCACTTTCCGGTTTCTGGGGCATAATTATCAAGCAAATTCACAAGCCAGGGCAAGGTTGGGCGGGGCAACCAGTTTGGCGTCCTTTAGATAACAAAAAATAAAATTTTAGGTGGGCAAAGGCGGGTCCCTGGTGCAATTCTGGGGGACGGGGAAGGCGTTGGGTTTTGGAAAAATTCAAGGGGTTATAGTCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATGGGGTAAGAAGAAGCCACGA