ORFeome > LOC100126628 ORF1 – XORFeome v1.0

LOC100126628 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253804
Gene Page ID:
ORF Xenbase ID: 17254917

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153772
Original XGC clone length: 831

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ839018
dbEST ID: 79656720
Trimmed Sequence: ATGAGTACCCAAAAATCAGAAAGCAGCAGAAAAAGGAAAAGCACAAAACCGCAAAAATCAGATGAAGTCAAAAGAAGGCTTCCCTTAAATGAAATTGAGGTTATGGAATCCTTTCATAAGGAGGAATCACAGTCTGGTGAACAGAACACAGCAAAAAGAAAGAGAGGACGGCCTAAAGGGAACAAAAACAAATACCCATCTTGGTCTGCTCTGCAGATCTCTTCATCCAGTGATGGAAAAAGTAACTTTCCTACCTCATCAGAATGTCCAAAAGTACTGGATAATGATGGGGTCAGGTCCCCACAAAATGAATGTCCTAAAGAAGAAGAATATCAACAAAAAGAAAGAAATAGGTCCAAAGGGAGCACAGCAAAGACACTGTGCAGTTCATCTGCCAAGGAAGATTCAAAATCTGGTGAACAGAAGACAGCAAAAGGAAAGAGAGGAAGGCCTAAAGGAAGCAAAAACAAATACCCATCTTGGTTTGCTCTGCAGCAGCGAACACCTGGAGCTCCAAAGATGGGAAGAGGGAGACCCAGAAAACCAGTTGAAACTAATGGCACTTTGGTTCCCAAGAGGCCACGAGGGAGGCCTAAAGGAAGTTTGAACAAAATCCCTTCTGCAAAAAAGCTTGCTGTCAGCATGGGAAGCTCTGGTGTACAGAAAGAGAGGGCGTCCGANGAAAGCATTTATTGCAACCTCCCAACTTTTAACTCCCCAAAAGAACCCAAAGGGAAGGGCCAAAAGAATGGTTAAAAATATCACCAAACTGGGAACCCCTTTGAATGTGGGTTTAAAGGGCGTCAAGGG
Full Trace Sequence: GGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTACCCAAAAATCAGAAAGCAGCAGAAAAAGGAAAAGCACAAAACCGCAAAAATCAGATGAAGTCAAAAGAAGGCTTCCCTTAAATGAAATTGAGGTTATGGAATCCTTTCATAAGGAGGAATCACAGTCTGGTGAACAGAACACAGCAAAAAGAAAGAGAGGACGGCCTAAAGGGAACAAAAACAAATACCCATCTTGGTCTGCTCTGCAGATCTCTTCATCCAGTGATGGAAAAAGTAACTTTCCTACCTCATCAGAATGTCCAAAAGTACTGGATAATGATGGGGTCAGGTCCCCACAAAATGAATGTCCTAAAGAAGAAGAATATCAACAAAAAGAAAGAAATAGGTCCAAAGGGAGCACAGCAAAGACACTGTGCAGTTCATCTGCCAAGGAAGATTCAAAATCTGGTGAACAGAAGACAGCAAAAGGAAAGAGAGGAAGGCCTAAAGGAAGCAAAAACAAATACCCATCTTGGTTTGCTCTGCAGCAGCGAACACCTGGAGCTCCAAAGATGGGAAGAGGGAGACCCAGAAAACCAGTTGAAACTAATGGCACTTTGGTTCCCAAGAGGCCACGAGGGAGGCCTAAAGGAAGTTTGAACAAAATCCCTTCTGCAAAAAAGCTTGCTGTCAGCATGGGAAGCTCTGGTGTACAGAAAGAGAGGGCGTCCGANGAAAGCATTTATTGCAACCTCCCAACTTTTAACTCCCCAAAAGAACCCAAAGGGAAGGGCCAAAAGAATGGTTAAAAATATCACCAAACTGGGAACCCCTTTGAATGTGGGTTTAAAGGGCGTCAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTACCCAAAAATCAGAAAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839017
dbEST ID: 79656719
Trimmed Sequence: AGGTCCATCAGTGCCACTGGTTTTCTCATTCTTTTGCACACTTGAGCCTTTAACCACATCAATGGGTCCAGTTGGTGATATTCTAACAATCTTTGGCCTTCCTCTGGGTCTTTTGGGAGTTAAAGTTGGAAGGTGCAATAAATGCTTCCTTGGACGCCCTCTCTTCTGTACACAAGAGCTTCCCATGCTGACAGCAAGCTTTTTTGCAGAAGGGATTTTGTTCAAACTTCCTTTAGGCCTCCCTCGTGGCCTCTTGGGAACCAAAGTGCCATTAGTTTCAACTGGTTTTCTGGGTCTCCCTCTTCCCATCTTTGGAGCTCCAGGTGTTCGCTGCTGCAGAGCAAACCAAGATGGGTATTTGTTTTTGCTTCCTTTAGGCCTTCCTCTCTTTCCTTTTGCTGTCTTCTGTTCACCAGATTTTGAATCTTCCTTGGCAGATGAACTGCACAGTGTCTTTGCTGTGCTCCCTTTGGACCTATTTCTTTCTTTTTGTTGATATTCTTCTTCTTTAGGACATTCATTTTGTGGGGACCTGACCCCATCATTATCCAGTACTTTTGGACATTCTGATGAGGTAGGAAAGTTACTTTTTCCATCACTGGATGAAAAGAACTGCAGAGCAGACCAAAATGGGAATTTGTTTTTGTTCCCTTTAAGCCGTCCCGCCCTTCCTTTTTGCTTTGTTCTTTTTCCCCGAAAGTTGAATCCTTCCTTTATAAAAG
Full Trace Sequence: AACGGACTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGTCCATCAGTGCCACTGGTTTTCTCATTCTTTTGCACACTTGAGCCTTTAACCACATCAATGGGTCCAGTTGGTGATATTCTAACAATCTTTGGCCTTCCTCTGGGTCTTTTGGGAGTTAAAGTTGGAAGGTGCAATAAATGCTTCCTTGGACGCCCTCTCTTCTGTACACAAGAGCTTCCCATGCTGACAGCAAGCTTTTTTGCAGAAGGGATTTTGTTCAAACTTCCTTTAGGCCTCCCTCGTGGCCTCTTGGGAACCAAAGTGCCATTAGTTTCAACTGGTTTTCTGGGTCTCCCTCTTCCCATCTTTGGAGCTCCAGGTGTTCGCTGCTGCAGAGCAAACCAAGATGGGTATTTGTTTTTGCTTCCTTTAGGCCTTCCTCTCTTTCCTTTTGCTGTCTTCTGTTCACCAGATTTTGAATCTTCCTTGGCAGATGAACTGCACAGTGTCTTTGCTGTGCTCCCTTTGGACCTATTTCTTTCTTTTTGTTGATATTCTTCTTCTTTAGGACATTCATTTTGTGGGGACCTGACCCCATCATTATCCAGTACTTTTGGACATTCTGATGAGGTAGGAAAGTTACTTTTTCCATCACTGGATGAAAAGAACTGCAGAGCAGACCAAAATGGGAATTTGTTTTTGTTCCCTTTAAGCCGTCCCGCCCTTCCTTTTTGCTTTGTTCTTTTTCCCCGAAAGTTGAATCCTTCCTTTATAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGTCCATCAGTGCCACTGGTT