ORFeome > LOC100127257 ORF1 – XORFeome v1.0

LOC100127257 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5811315
Gene Page ID: 5811292
ORF Xenbase ID: 17254971

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC154974
Original XGC clone length: 756

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ839020
dbEST ID: 79656722
Trimmed Sequence: ATGATTGTCGATTCTCCAAAAATTAAGAATTTGATAATGTCATATTTGGAAGAAAAGAAAGGGAAGCCATTTGAGCTGGCAGTTGATGCTGGCTGTGGGACAGGGAGGTCCACTCGGACTTTGGCTCCATATTTCCAGAAGGTGGTTGGAATAGATGTAAGTGAGTCCCAGTTAAGTGTGGCCAGAAAATGTACTTCACATGAGAACATCTCTTACCAGATTTCCCCAGCTGAGGAGCTGCCTCTGGAAGATGCATCAGTGGATCTGATTAATGCAGGCCTTGCTGCTCATTGGTTCAATCCTGAGAAATTTGGACAGGAAGCAGCTCGGGTGCTTAAACATGGAGGCTGTTTGGCCTTATATTGTTTTTCATTGGTATTTGAGATTGAGTATAAGGACAAGTCAGAGGAACTAACTGCTGCCTTTAATGAGGCTTTGTTAATTCTGCTTGAATTTCATAAGAAAGTCGTCTGTGAAGTAAAGGCTATGTATCAGGAATTATTCAGTGCCATACCATTTAAAGATAAGCAGAGGATCAGCGGCATCTGTGAAGTATTTCCCTTAACAGTCCCTGAAATAATGAGTTTCCTTCATGTCATTTGTTCGTACAAGGAGTTCCTAGAGCAAGACAAAGATAAGGCCACAACTTTTCTACCAGATTTAAAGAAAAAGTTTTTAGATATATTGGGATGAATCTGCTGCTGATGCTCTAGCAATTTCTGTATAATAATTTCTGTCCTTCTTGCTTCCCAATCCTTTGCCCAACTTTTTCTTGTTCAAAGTTTTGGGGTTTTAAAAAAGAAACATTTTCTTTTATAAATATTGTTTTGCCT
Full Trace Sequence: CCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTGTCGATTCTCCAAAAATTAAGAATTTGATAATGTCATATTTGGAAGAAAAGAAAGGGAAGCCATTTGAGCTGGCAGTTGATGCTGGCTGTGGGACAGGGAGGTCCACTCGGACTTTGGCTCCATATTTCCAGAAGGTGGTTGGAATAGATGTAAGTGAGTCCCAGTTAAGTGTGGCCAGAAAATGTACTTCACATGAGAACATCTCTTACCAGATTTCCCCAGCTGAGGAGCTGCCTCTGGAAGATGCATCAGTGGATCTGATTAATGCAGGCCTTGCTGCTCATTGGTTCAATCCTGAGAAATTTGGACAGGAAGCAGCTCGGGTGCTTAAACATGGAGGCTGTTTGGCCTTATATTGTTTTTCATTGGTATTTGAGATTGAGTATAAGGACAAGTCAGAGGAACTAACTGCTGCCTTTAATGAGGCTTTGTTAATTCTGCTTGAATTTCATAAGAAAGTCGTCTGTGAAGTAAAGGCTATGTATCAGGAATTATTCAGTGCCATACCATTTAAAGATAAGCAGAGGATCAGCGGCATCTGTGAAGTATTTCCCTTAACAGTCCCTGAAATAATGAGTTTCCTTCATGTCATTTGTTCGTACAAGGAGTTCCTAGAGCAAGACAAAGATAAGGCCACAACTTTTCTACCAGATTTAAAGAAAAAGTTTTTAGATATATTGGGATGAATCTGCTGCTGATGCTCTAGCAATTTCTGTATAATAATTTCTGTCCTTCTTGCTTCCCAATCCTTTGCCCAACTTTTTCTTGTTCAAAGTTTTGGGGTTTTAAAAAAGAAACATTTTCTTTTATAAATATTGTTTTGCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGTCGATTCTCCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839019
dbEST ID: 79656721
Trimmed Sequence: AGATTTGGATGCAAGAAGACAGAAATAATATACATGAAATCCTAGAGCATCAGAAGCAGATTCACCCAATATATCTAAAAACCTTTTCTCTAAATCTTGTAGAAAAGCTGTGGCCTTATCTTTGTCTTGCTCTAGGAACTCCTTGTACGAACAAATTGCCTGAAGGAAACTCATTATTTCAGGGACTGTTAAGGGAAATACTTCACAGATGCCGCTGATCCTCTGCTTATCTTTAAATGGTATGGCACTGAATAATTCCTGATACATAGCCTTTACTTCACAGACGACTTTCTTATGAAATTCAAGCAGAATTAACAAAGCCTCATTAAAGGCAGCAGTTAGTTCCTCTGACTTGTCCTTATACTCAATCTCAAATACCAATGAAAAACAATATAAGGCCAAACAGCCTCCATGTTTAAGCACCCGAGCTGCTTCCTGTCCAAATTTCTCAGGATTGAACCAATGAGCAGCAAGGCCTGCATTAATCAGATCCACTGATGCATCTTCCAGAGGCAGCTCCTCAGCTGGGGAAATCTGGTAAGAGATGTTCTCATGTGAAGTACATTTTCTGGGCACACTTAACTGGGACTCACTTACATCTATTCCAACCCACCTCTGGAAAAATGGAACCAAAGTCCCGAGGGGACCGCCCGGGTCCGACAACCCGCTCCACCGGGCCCCTCAAAGTGGCCTTCCCTTTCTTTTCCCTCCCATTTTGAAAGTTAACAAAAATCCTAAAATTTTTGGAAAAAAACAAACAAAACTGAGGGGTGCCCGAC
Full Trace Sequence: GGGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGATTTGGATGCAAGAAGACAGAAATAATATACATGAAATCCTAGAGCATCAGAAGCAGATTCACCCAATATATCTAAAAACCTTTTCTCTAAATCTTGTAGAAAAGCTGTGGCCTTATCTTTGTCTTGCTCTAGGAACTCCTTGTACGAACAAATTGCCTGAAGGAAACTCATTATTTCAGGGACTGTTAAGGGAAATACTTCACAGATGCCGCTGATCCTCTGCTTATCTTTAAATGGTATGGCACTGAATAATTCCTGATACATAGCCTTTACTTCACAGACGACTTTCTTATGAAATTCAAGCAGAATTAACAAAGCCTCATTAAAGGCAGCAGTTAGTTCCTCTGACTTGTCCTTATACTCAATCTCAAATACCAATGAAAAACAATATAAGGCCAAACAGCCTCCATGTTTAAGCACCCGAGCTGCTTCCTGTCCAAATTTCTCAGGATTGAACCAATGAGCAGCAAGGCCTGCATTAATCAGATCCACTGATGCATCTTCCAGAGGCAGCTCCTCAGCTGGGGAAATCTGGTAAGAGATGTTCTCATGTGAAGTACATTTTCTGGGCACACTTAACTGGGACTCACTTACATCTATTCCAACCCACCTCTGGAAAAATGGAACCAAAGTCCCGAGGGGACCGCCCGGGTCCGACAACCCGCTCCACCGGGCCCCTCAAAGTGGCCTTCCCTTTCTTTTCCCTCCCATTTTGAAAGTTAACAAAAATCCTAAAATTTTTGGAAAAAAACAAACAAAACTGAGGGGTGCCCGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATTTGGATGCAAGAAGACAGA