ORFeome > LOC100127259 ORF1 – XORFeome v1.0

LOC100127259 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 6252767
Gene Page ID: 956055
ORF Xenbase ID: 17254977

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154977
Original XGC clone length: 1059

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ839036
dbEST ID: 79656738
Trimmed Sequence: ATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCACATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCTACCGCTCAGGGGTCGCTGTGCTCGGAGTGGCTGACTTTGGCCTTAGTAAAATTTGCGCTGGCCTGGCACCCCCGCGGGAGGAGACCGGCGGTGTTGGGGCCCGGGGAAACCGGAATGGGATGTTGATAAATAGGGGCTGGTGTTCGCGTTGTTGGCAGAAGTCCTTATGGCTCTAATGGTTGGGGAGGGGGGCGGGGGGGGGGGCGC
Full Trace Sequence: GCCCCCAAGTAATAGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCACATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCTACCGCTCAGGGGTCGCTGTGCTCGGAGTGGCTGACTTTGGCCTTAGTAAAATTTGCGCTGGCCTGGCACCCCCGCGGGAGGAGACCGGCGGTGTTGGGGCCCGGGGAAACCGGAATGGGATGTTGATAAATAGGGGCTGGTGTTCGCGTTGTTGGCAGAAGTCCTTATGGCTCTAATGGTTGGGGAGGGGGGCGGGGGGGGGGGCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCGCAGCCCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839035
dbEST ID: 79656737
Trimmed Sequence: AGCAGCGCATGTAACTTGGTCCATTCGAGTCTCCAGCTCAAACGCATCGGGTCGATCCTGTGGATTCGCAGCCAGCATGTCTTTCAGCAGTTGCCGGATGCCTTCAGACATGGAAGTCCTACGTTTCTGTGGGATGTGAAGTTCCATCTTTGGGTTCTCTAGCAGTGCCTCCCCCACGGGGACAATCTCAGTGCCCTGCTTTATGTAGGTCCCGAGCAGCTCCCTCTTGGTCTCTGCATCCACAAATGTAATTCGTTCGATCATGGCCCAGATTATTATGCCCAGGGCAAATATGTCAGCCTTGGCAGTGTAGTGACCCTCCCACACCTCTGGAGCCATATAGAAGTCTGAGCCACACGCTGATGACAGCCAGTATTTATTCACATTCACAGTCCTGTTTTCATTGGTGCCAACACCGGTGGTCTCCTTCCCGCGGGGTGTTAGGCCAGCGCACACTTTACTAAGGCCAAAGTCAGCCACTTTGAGCACAGGGACCCCTGAGCGCTCGGTAATGAGTATATTGTCCGGTTTCAGATCACGGTGAACAATCTGGTTCTTGTGCAGGAATGCTATAGCACTGGTCAGCTGCAGCATAAAGCTCTTGTTTAAAGCAGGGTCTGGTCGTCTGGACAGGACATACTGATTAAAAACACCGCCCCCCCCAAAACTCCATTACCAAACCAAAAGGAAACAAAGCTTCCTCAAAAAAAACC
Full Trace Sequence: GGAAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCAGCGCATGTAACTTGGTCCATTCGAGTCTCCAGCTCAAACGCATCGGGTCGATCCTGTGGATTCGCAGCCAGCATGTCTTTCAGCAGTTGCCGGATGCCTTCAGACATGGAAGTCCTACGTTTCTGTGGGATGTGAAGTTCCATCTTTGGGTTCTCTAGCAGTGCCTCCCCCACGGGGACAATCTCAGTGCCCTGCTTTATGTAGGTCCCGAGCAGCTCCCTCTTGGTCTCTGCATCCACAAATGTAATTCGTTCGATCATGGCCCAGATTATTATGCCCAGGGCAAATATGTCAGCCTTGGCAGTGTAGTGACCCTCCCACACCTCTGGAGCCATATAGAAGTCTGAGCCACACGCTGATGACAGCCAGTATTTATTCACATTCACAGTCCTGTTTTCATTGGTGCCAACACCGGTGGTCTCCTTCCCGCGGGGTGTTAGGCCAGCGCACACTTTACTAAGGCCAAAGTCAGCCACTTTGAGCACAGGGACCCCTGAGCGCTCGGTAATGAGTATATTGTCCGGTTTCAGATCACGGTGAACAATCTGGTTCTTGTGCAGGAATGCTATAGCACTGGTCAGCTGCAGCATAAAGCTCTTGTTTAAAGCAGGGTCTGGTCGTCTGGACAGGACATACTGATTAAAAACACCGCCCCCCCCAAAACTCCATTACCAAACCAAAAGGAAACAAAGCTTCCTCAAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCAGCGCATGTAACTTGG