ORFeome > LOC100158348 ORF1 – XORFeome v1.0

LOC100158348 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252937
Gene Page ID:
ORF Xenbase ID: 17255007

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124872
Original XGC clone length: 1470

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ838345
dbEST ID: 79656047
Trimmed Sequence: ATGAAGGGATCCCAACAGAACAGTGCAGGGCGTAAGGGCCCAGGATCCCCCACAGACCCCAGTGCCATGCTTAGCAAAGAGGAAGCAGCGGTGCACCGAGATGGAAAGCCCCCTTACAGCTATGCCAACCTCATCCAGTACGCCATCAATTCTGCCCCAGCCAAACGCATGACCCTCAGTGAGATCTACCGCTGGATCTGTGACAACTTCCCGTATTATCGGAATGCTGGGGTAGGCTGGAAGAACTCAATACGACACAATCTGTCCTTAAATAAATGCTTCAGGAAAGTTCCACGGCCCAGAGATGATCCAGGAAAGGGATCCTACTGGATGATTGACAGTTGCCCCAAAGAAGATGTAACTCTGCCTCGCAGGAAAAGGCCGCATCCAGACGATGAGGTTTCCCAGGATTCATTTGAACAAGAAGTCAACAAAAGCCCCCTGAGCTCGGCCAATGAGGTGACCATGCCCCAAGAAGGCACCCAAGGGCATCCTATGAACAACAACTCCCCGCTCCCTACCTACAGCCAGGCCAACCCCACTCAGATGCCACCAGATTCCCGGGCTCCTCCATACAACAACAACGACTGCTACAAGTTCTCCTTCTCAGAAAGCACCTTCCCGGATCTGAGCTGTTCCTTTCGGAGTCTGTATCACTCTCTGCTGGGCAAAACGGGGGGAAAGAGGAGAACAAGATCTGTACAACTCTATGCCAAACAAACCAAGGTCTGGCCCCCTTACATTCCTAAAATAACATCAACCAAACTTCTGGTTAGTTCCAAGCCAAAAAGGCTGGGTTCAACTTCCCCTCTTAATCCTGCC
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGGATCCCAACAGAACAGTGCAGGGCGTAAGGGCCCAGGATCCCCCACAGACCCCAGTGCCATGCTTAGCAAAGAGGAAGCAGCGGTGCACCGAGATGGAAAGCCCCCTTACAGCTATGCCAACCTCATCCAGTACGCCATCAATTCTGCCCCAGCCAAACGCATGACCCTCAGTGAGATCTACCGCTGGATCTGTGACAACTTCCCGTATTATCGGAATGCTGGGGTAGGCTGGAAGAACTCAATACGACACAATCTGTCCTTAAATAAATGCTTCAGGAAAGTTCCACGGCCCAGAGATGATCCAGGAAAGGGATCCTACTGGATGATTGACAGTTGCCCCAAAGAAGATGTAACTCTGCCTCGCAGGAAAAGGCCGCATCCAGACGATGAGGTTTCCCAGGATTCATTTGAACAAGAAGTCAACAAAAGCCCCCTGAGCTCGGCCAATGAGGTGACCATGCCCCAAGAAGGCACCCAAGGGCATCCTATGAACAACAACTCCCCGCTCCCTACCTACAGCCAGGCCAACCCCACTCAGATGCCACCAGATTCCCGGGCTCCTCCATACAACAACAACGACTGCTACAAGTTCTCCTTCTCAGAAAGCACCTTCCCGGATCTGAGCTGTTCCTTTCGGAGTCTGTATCACTCTCTGCTGGGCAAAACGGGGGGAAAGAGGAGAACAAGATCTGTACAACTCTATGCCAAACAAACCAAGGTCTGGCCCCCTTACATTCCTAAAATAACATCAACCAAACTTCTGGTTAGTTCCAAGCCAAAAAGGCTGGGTTCAACTTCCCCTCTTAATCCTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGGATCCCAACAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838344
dbEST ID: 79656046
Trimmed Sequence: GGCAATGGAGTCCCAGTCAAAATCATCCTGAATGTCGTCGCTGCTCTGTGGGTAACGAAGTGTCGGACGTTGGGGTGGGTACAAAGCGCGTTGTGGGTGGCGTCCTTGCTGGCTATAGATTGGTGGTGCCTGCGACTGGATGGGATAACCGGAGGAAACGGTGAAGGTGTGACCGCAGGAAACGGGAGGCGGCTGATTCTGCCCGTATGCATTTACTGCCATGTTATGTCCAGGCTTCCCTCCCCGTAGAGCGCAGGCACTGCTGGTAGTTGGTGGCATACAGGGAGCCTGGCAAGATGGAGGCTGTCCATGGTTTTGGGGGAGGAGGCCAGTCGTACTCAGGAGATGGCTTAGGGAATCACATAGGCTGGCAATGTGATCCTGGTCCAGGCTCCAGTTCTTCAGTTCAGCCTGACGCAGACTCTCCATCAGATCTGAGAATTGGGACAGATCCACAGTGGACCAATCCAAACTGCTGACTATCTTGAAGCTTTCCTTTAAGGAGTCAATATTCGAGCACCAGTCACTGGGAAGCCCCAAAGACATGCCAGGAACTGGGGGGCGAGGCATTTGCTGCTGGGGCAGATAAAAAAGTTGCTGGTGTTAAGCTTGATGGTTAGGAAGAGGCGGGCCACTGATGCTGGGAACTTTTGTGGGGTTGCAAATTAAAGGAAACCGCAACAACCTTCCTGCTGGTAAAATACAGCAACCTCAAAGAACTTGTACTTTC
Full Trace Sequence: CGGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAATGGAGTCCCAGTCAAAATCATCCTGAATGTCGTCGCTGCTCTGTGGGTAACGAAGTGTCGGACGTTGGGGTGGGTACAAAGCGCGTTGTGGGTGGCGTCCTTGCTGGCTATAGATTGGTGGTGCCTGCGACTGGATGGGATAACCGGAGGAAACGGTGAAGGTGTGACCGCAGGAAACGGGAGGCGGCTGATTCTGCCCGTATGCATTTACTGCCATGTTATGTCCAGGCTTCCCTCCCCGTAGAGCGCAGGCACTGCTGGTAGTTGGTGGCATACAGGGAGCCTGGCAAGATGGAGGCTGTCCATGGTTTTGGGGGAGGAGGCCAGTCGTACTCAGGAGATGGCTTAGGGAATCACATAGGCTGGCAATGTGATCCTGGTCCAGGCTCCAGTTCTTCAGTTCAGCCTGACGCAGACTCTCCATCAGATCTGAGAATTGGGACAGATCCACAGTGGACCAATCCAAACTGCTGACTATCTTGAAGCTTTCCTTTAAGGAGTCAATATTCGAGCACCAGTCACTGGGAAGCCCCAAAGACATGCCAGGAACTGGGGGGCGAGGCATTTGCTGCTGGGGCAGATAAAAAAGTTGCTGGTGTTAAGCTTGATGGTTAGGAAGAGGCGGGCCACTGATGCTGGGAACTTTTGTGGGGTTGCAAATTAAAGGAAACCGCAACAACCTTCCTGCTGGTAAAATACAGCAACCTCAAAGAACTTGTACTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAATGGAGTCCCAGT