ORFeome > LOC100158373 ORF1 – XORFeome v1.0

LOC100158373 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5952684
Gene Page ID: 5952676
ORF Xenbase ID: 17255043

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124936
Original XGC clone length: 906

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ837277
dbEST ID: 79654979
Trimmed Sequence: 0
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCCGTACTATGCGGCAAATGAGGATCAATGCTTTTTTGGATGCCGTCTTTGTACACAGATGTGGCACCATGAAATGCTTCAACCTGATTTTGCTTGTTAGCCTGTCATTTATCAAGAATTCAGCAGCAGCAGGTAACTGGTGCTATGAAATCCAGGGATGTGCAGGCACAGGACCCAGGCTTTGGAGCAAACATTTTCCGTTCTGTGGAGGACAACAGCAATCGCCAATAAATATTCACACCAAAGGTGCTGTTTTTAAGGAATCACTGAAGTTAGTTCAGTTTAACTTGACAGGCTATGGTGACATTGTACGGAAACTGAGTATTACAAATAATGGCCATTCTGCCCAAGTAAACCTGCCATCAGGTATTGAAATTTCAGGAGGTGGACTTTCAGGAACTTATGTTGCAACACAGTTTCATTTCCATTGGGGCAGTGAAGAATTTCATGGATCTGAACATACCATAGATGGTGAAAAATTTCCAATGGAGCTTCACATAGTTCACGCAAGAAAAAATGCCACCGGTGGCAGTGGGGATCTGGCTGTTCTTGGATTCTTTTATGAAGAAACTTCATAGAATAATACAAAGTATGATTCGCTAATTAAATCCATAGAAGCCATCACTGCTGTAGATGGAATTAGAAATTTCTCATCTAACTTGGCGAAACTGATTCCACAAAATGAAGCACTCAAACCTTTACACCAGTACCATGGGTCACTCGGCACTCCCCCATTGCACCGAGAAGGTCACCTTGGAATTTATTCCTTACATCAATAAAACTGAAAAAACACCAGCCTTCAGGCTTTTCCATCAAGAACCCAACTTTTTACCGCCATATCGAAACGAATTGTTTGGAAAAAATTTTTAGGGGGCTTGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATGCTTCAACCTGATTTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837276
dbEST ID: 79654978
Trimmed Sequence: TGACATTATTGTAAGGAAAGAAACTATAAAGCAGATAAACAAAGACTGGAAAGAGGACACTATCACTTGGCTGCTTGAGGTGTAAACAATCCTATTTCCCCGTTTCTGCACAGGCCTGAAATTTTCCACCATTCGTTCGATCGCTGTAAAATTTAGGTTGTGATGGAAAGCCTGAAGCTGCTGTTTGCTCAGTTTAATAGTTGTATTGAATAAAGTCCAAGTGACTGTCTCGGTGCATGGCGGAGTGGTGAGTGACCCATTGTACCTGTAGTAAAGCTTGAGTGCTTCATTTTGTGGAATCACTTTTGCCAAGTTAGCTGAGAAATTTTTAATTCCATCTACAGCAGTGATGGCTTCTATGGATTTAATTAACGAATCATACTCTGTATTATTCTTTGAAGTTTCTTCATAAAAGAATCCGACAACAGCCACATCCGCACTGCCACCGCTGGCATTTTTTCTTGCGGGAAGGATAGAAAAGTCCATCGGCAATTGGATATCATCTACAAATATGTTCGGGATCCGGGAATTGGTACATTGCCCCAGCCACATGAGAAAGTGATGCGGCGTAGATGCAAAACCCTCACACCCTCACCTCCAAAACTTAGGTAGCATTATAGGTGGGGTGAAGGGGCAAAGGGGGTAGTACTTCGGTTACCTTAATTTATTCCCAAAAACCGTATCGGGGTTAAACGGGGGGGGG
Full Trace Sequence: AAAACTGCTTATGACCATGTAATACGACTCACTATAAGGGGATATCAGCTGGATGGCAGAGAGTGATTTTATTTTAGACGGACATCGACCTGTTCGTCGCGACAGGGGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGACATTATTGTAAGGAAAGAAACTATAAAGCAGATAAACAAAGACTGGAAAGAGGACACTATCACTTGGCTGCTTGAGGTGTAAACAATCCTATTTCCCCGTTTCTGCACAGGCCTGAAATTTTCCACCATTCGTTCGATCGCTGTAAAATTTAGGTTGTGATGGAAAGCCTGAAGCTGCTGTTTGCTCAGTTTAATAGTTGTATTGAATAAAGTCCAAGTGACTGTCTCGGTGCATGGCGGAGTGGTGAGTGACCCATTGTACCTGTAGTAAAGCTTGAGTGCTTCATTTTGTGGAATCACTTTTGCCAAGTTAGCTGAGAAATTTTTAATTCCATCTACAGCAGTGATGGCTTCTATGGATTTAATTAACGAATCATACTCTGTATTATTCTTTGAAGTTTCTTCATAAAAGAATCCGACAACAGCCACATCCGCACTGCCACCGCTGGCATTTTTTCTTGCGGGAAGGATAGAAAAGTCCATCGGCAATTGGATATCATCTACAAATATGTTCGGGATCCGGGAATTGGTACATTGCCCCAGCCACATGAGAAAGTGATGCGGCGTAGATGCAAAACCCTCACACCCTCACCTCCAAAACTTAGGTAGCATTATAGGTGGGGTGAAGGGGCAAAGGGGGTAGTACTTCGGTTACCTTAATTTATTCCCAAAAACCGTATCGGGGTTAAACGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGACATTATTGTAAGGAAAGA