ORFeome > LOC100158385 ORF1 – XORFeome v1.0

LOC100158385 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252921
Gene Page ID:
ORF Xenbase ID: 17255055

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC124953
Original XGC clone length: 648

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ837427
dbEST ID: 79655129
Trimmed Sequence: ATGGAGTCCTTGGCCGTAAAGGAAGGAGGGGAGGAAGTTGAAGAACAGCAGAAAGCAGAAGAGGGAGAAGCAGAAGAACAAGAGGAAGGAGAATCAGAAGAACAAGAGGAAGGAGAAACAGAAGAACAAGAGGAAGGGGAAGCAGAAGAGGAGGAAGGGGAAGACTGGTGTATAGGCTGCAGTGATGAGGAGGTTGAGGAACCTGATGGGTGGATTCCACCTCTAGAAGACATTAAAAGACTTTATGAGTTGTTGGCCAAAGAGGGAACGCTGCCTTTGCAAGTGGACATACTCCTCCACCGGCCTCCCACCCCTGAACCCGACTCTCTGGATGATGAATCTGATCAAGAGGCAGAGGAGGAGGAAGAAGAGCAAGACATGCCACTTGTTCCCACTGAATTTGATTTCAACGATGAACCCGTCACCCCCAAGAATGCGCTCATTGACCGCCGCAGAACGCCAGGGAGCACCGGCCGCAGCCACAAGAGAGAGGCCCAACTGGACGAGGTTCTGTCCGACATGAAGCGCCACAAGAAGATTGAGGAACAGATCCTAAAAACTGGCCGCGACCTCTTTGACATGGACCCTCACTCCGTTCCCACCCCAAAACGCTCTTCTGCCATCTTCCCTCATCAGCGGAAATACCTG
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCTTGGCCGTAAAGGAAGGAGGGGAGGAAGTTGAAGAACAGCAGAAAGCAGAAGAGGGAGAAGCAGAAGAACAAGAGGAAGGAGAATCAGAAGAACAAGAGGAAGGAGAAACAGAAGAACAAGAGGAAGGGGAAGCAGAAGAGGAGGAAGGGGAAGACTGGTGTATAGGCTGCAGTGATGAGGAGGTTGAGGAACCTGATGGGTGGATTCCACCTCTAGAAGACATTAAAAGACTTTATGAGTTGTTGGCCAAAGAGGGAACGCTGCCTTTGCAAGTGGACATACTCCTCCACCGGCCTCCCACCCCTGAACCCGACTCTCTGGATGATGAATCTGATCAAGAGGCAGAGGAGGAGGAAGAAGAGCAAGACATGCCACTTGTTCCCACTGAATTTGATTTCAACGATGAACCCGTCACCCCCAAGAATGCGCTCATTGACCGCCGCAGAACGCCAGGGAGCACCGGCCGCAGCCACAAGAGAGAGGCCCAACTGGACGAGGTTCTGTCCGACATGAAGCGCCACAAGAAGATTGAGGAACAGATCCTAAAAACTGGCCGCGACCTCTTTGACATGGACCCTCACTCCGTTCCCACCCCAAAACGCTCTTCTGCCATCTTCCCTCATCAGCGGAAATACCTGCCAACTTTCTTGTACAAAGTGGGAATTTTAAAAAACATTGGTTATCGTTTGTTGGAACGAACAGGGTCCTATTAGTCAAAATAAAAACATTTATTTGCCATCCGCCTAAATCCCCCATAATGAAGTCCGATGAAAATGGGAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCTTGGCCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837426
dbEST ID: 79655128
Trimmed Sequence: GTATTTCCGCTGATGAGGGAAGATGGCAGAAGAGCGTTTTGGGGTGGGAACGGAGTGAGGGTCCATGTCAAAGAGGTCGCGGCCAGTTTTTAGGATCTGTTCCTCAATCTTCTTGTGGCGCTTCATGTCGGACAGAACCTTGTCCAGTTGGGCCTCTCTCTTGTGGCTGCGGCCGGTGCTCCCTGGCGTTCTGCGGCGGTCAATGAGCGCATTCTTGGGGGTGACGGGTTCGTCGTTGAAATCAAATTCAGTGGGAACAAGTGGCATGTCTTGCTCTTCTTCCTCCTCCTCTGCCTCTTGATCAGATTCATCATCCAGAGAGTCCGGTTCAGGGGTGGGAGGCCGGTGGAGTATTATGTCCACTTTAAAAGGCACCGTTCCCTCTTTGTCCAACAACTCATAAAGTCGTTTAGTGTCGGTGGGAGGTGGAAGCCGCCAATCAGGTTCATCGGCCTCCTCCTCACTGGAGGCAAGACACCAATACTACAATGCGGTCTCTTCCGCGGGCGCGGGGGGGGGGGCGGCGGGTGGGCGGGCCACTGATCCACGGGGTACCCTCCTCTCCNACCCCCGCGTCTCCGGGGGTGAATTTCTACGGTGTTCTCTTTAGGTACAAGGTTGCCGGGGGGCAAAGGGTGGGAGGGGGGGGGGGGTGTGGGGGAGGGGGTGGGAAATAATAGGGGGGGGGGTGGTAAAGGAATAGTATTACGGTGTGAGANNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAGAAAAAAAAAA
Full Trace Sequence: AAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATTTCCGCTGATGAGGGAAGATGGCAGAAGAGCGTTTTGGGGTGGGAACGGAGTGAGGGTCCATGTCAAAGAGGTCGCGGCCAGTTTTTAGGATCTGTTCCTCAATCTTCTTGTGGCGCTTCATGTCGGACAGAACCTTGTCCAGTTGGGCCTCTCTCTTGTGGCTGCGGCCGGTGCTCCCTGGCGTTCTGCGGCGGTCAATGAGCGCATTCTTGGGGGTGACGGGTTCGTCGTTGAAATCAAATTCAGTGGGAACAAGTGGCATGTCTTGCTCTTCTTCCTCCTCCTCTGCCTCTTGATCAGATTCATCATCCAGAGAGTCCGGTTCAGGGGTGGGAGGCCGGTGGAGTATTATGTCCACTTTAAAAGGCACCGTTCCCTCTTTGTCCAACAACTCATAAAGTCGTTTAGTGTCGGTGGGAGGTGGAAGCCGCCAATCAGGTTCATCGGCCTCCTCCTCACTGGAGGCAAGACACCAATACTACAATGCGGTCTCTTCCGCGGGCGCGGGGGGGGGGGCGGCGGGTGGGCGGGCCACTGATCCACGGGGTACCCTCCTCTCCNACCCCCGCGTCTCCGGGGGTGAATTTCTACGGTGTTCTCTTTAGGTACAAGGTTGCCGGGGGGCAAAGGGTGGGAGGGGGGGGGGGGTGTGGGGGAGGGGGTGGGAAATAATAGGGGGGGGGGTGGTAAAGGAATAGTATTACGGTGTGAGANNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAGAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTTCCGCTGATGAGGGAAGAT