ORFeome > loc100496061 ORF1 – XORFeome v1.0

loc100496061 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: loc100496061
Gene ID: 5873321
Gene Page ID: 5873314
ORF Xenbase ID: 17282349

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129779
Original XGC clone length: 630

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ838658
dbEST ID: 79656360
Trimmed Sequence: ATGGGGTCTCCCCAGAGGGAAATATTATGTAAGGTGCTGGTAGTGGGTGACCTTGGGGTTGGAAAGACGTCAATCATCCAGCGTTATGTCCACAACGTTTTCTCTCAGTGCTACAGAGCTACCATTGGCGTGGACTTTGCCCTCAAGATTGTAAACTGGGACTTGGACACTGTGGTTAGACTGCAACTCTGGGACATTGCAGGACAGGAGAGATTTGGTCACATGACACGGCTGTATTACCGTGAGGCAGTGGGCGCTGTTGTGGTATGTGACCTAGGTCGGGTGGCCACAGTGGAGTCGGTGTCTCGTTGGAAAGAAGATCTGGATTCCAAGGTGTGCTTGCAGAATGGAAACCCTATCCCCGTCATACTGCTTGGGAACAAATGTGACCAAGTCCCCTTGGGCACATCCGTGTCAAATCTGGAGCAGCTCGGCCAAGAGTTGGGATTTAGTTACAGTCATGTGACTTCTGCCAAGGAGAATGTGAATATTGACATGGCAATCTCTTCTTTAATAAAAGAAATTATAGCCAATGATGAAGATTCTGAGCCTACAAATGATCCCACTATTATCCAGCCATCTCTGCACCCCTCAGTGAACAAGGCCTGTTCCCAGTGTTTCAGGTTCGTG
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGTCTCCCCAGAGGGAAATATTATGTAAGGTGCTGGTAGTGGGTGACCTTGGGGTTGGAAAGACGTCAATCATCCAGCGTTATGTCCACAACGTTTTCTCTCAGTGCTACAGAGCTACCATTGGCGTGGACTTTGCCCTCAAGATTGTAAACTGGGACTTGGACACTGTGGTTAGACTGCAACTCTGGGACATTGCAGGACAGGAGAGATTTGGTCACATGACACGGCTGTATTACCGTGAGGCAGTGGGCGCTGTTGTGGTATGTGACCTAGGTCGGGTGGCCACAGTGGAGTCGGTGTCTCGTTGGAAAGAAGATCTGGATTCCAAGGTGTGCTTGCAGAATGGAAACCCTATCCCCGTCATACTGCTTGGGAACAAATGTGACCAAGTCCCCTTGGGCACATCCGTGTCAAATCTGGAGCAGCTCGGCCAAGAGTTGGGATTTAGTTACAGTCATGTGACTTCTGCCAAGGAGAATGTGAATATTGACATGGCAATCTCTTCTTTAATAAAAGAAATTATAGCCAATGATGAAGATTCTGAGCCTACAAATGATCCCACTATTATCCAGCCATCTCTGCACCCCTCAGTGAACAAGGCCTGTTCCCAGTGTTTCAGGTTCGTGCCAACTTTCTTGTACCAAGTTTGGCATAAAAAGAAACCATTGCTTAATCATTTTGTTGCAACCAAACGGGTCCCCTATCAATCCAAATAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTCTCCCCAGAGGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838657
dbEST ID: 79656359
Trimmed Sequence: GAACCTTGAACACTGGGAACAGGCCTTGTTCACTGAGGGGTGCAGAGATGGCTGGATAATAGTGGGATCATTTGTAGGCTCAGAATCTTCATCATTGGCTATAATTTCTTTTATTAAAGAAGAGATTGCCATGTCAATATTCACATTCTCCTTGGCAGAAGTCACATGACTGTAACTAAATCCCAACTCTTGGCCGAGCTGCTCCAGATTTGACACGGATGTGCCCAAGGGGACTTGGTCACATTTGTTCCCAAGCAGTATGACGGGGATAGGGTTTCCATTCTGCAAGCACACCTTGGAATCCAGATCTTCTTTCCAACGAGACACCGACTCCACTGTGGCCACCCGACCTAGGTCACATACCACAACAGCGCCCACTGCCTCACGGTAATACAGCCGTGTCATGTGACCAAATCTCTCCTGTCCTGCAATGTCCCAGAGTTGCAGTCTAACCACAGTGTCCAAGTCCCAGTTTACCATCTTGAGGGCAGAGTCCACGCCAATGGTAGCTCTGTAGCACTGATAAAAAAAGTTGTGGACAGAACGCTGGATGATTGACATCTTTTCCACCCCCAGGTCCCCCGCCACCACGCACCTACATAATATTTTCCCCCGGGGAAACCCCATGATGCCCACTTTTTTTTTACATATTTTGCCATAGGAAAAAAACATAGGGTAAGCGATTTTGTTTTCACGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAGAACTGAATCCTTCGCCACTGGCCCCTCC
Full Trace Sequence: AACCGTCTATTGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACCTTGAACACTGGGAACAGGCCTTGTTCACTGAGGGGTGCAGAGATGGCTGGATAATAGTGGGATCATTTGTAGGCTCAGAATCTTCATCATTGGCTATAATTTCTTTTATTAAAGAAGAGATTGCCATGTCAATATTCACATTCTCCTTGGCAGAAGTCACATGACTGTAACTAAATCCCAACTCTTGGCCGAGCTGCTCCAGATTTGACACGGATGTGCCCAAGGGGACTTGGTCACATTTGTTCCCAAGCAGTATGACGGGGATAGGGTTTCCATTCTGCAAGCACACCTTGGAATCCAGATCTTCTTTCCAACGAGACACCGACTCCACTGTGGCCACCCGACCTAGGTCACATACCACAACAGCGCCCACTGCCTCACGGTAATACAGCCGTGTCATGTGACCAAATCTCTCCTGTCCTGCAATGTCCCAGAGTTGCAGTCTAACCACAGTGTCCAAGTCCCAGTTTACCATCTTGAGGGCAGAGTCCACGCCAATGGTAGCTCTGTAGCACTGATAAAAAAAGTTGTGGACAGAACGCTGGATGATTGACATCTTTTCCACCCCCAGGTCCCCCGCCACCACGCACCTACATAATATTTTCCCCCGGGGAAACCCCATGATGCCCACTTTTTTTTTACATATTTTGCCATAGGAAAAAAACATAGGGTAAGCGATTTTGTTTTCACGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAGAACTGAATCCTTCGCCACTGGCCCCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACCTTGAACACTGGGA