ORFeome > LOC397788 ORF1 – XORFeome v1.0

LOC397788 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252906
Gene Page ID:
ORF Xenbase ID: 17255133

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC128913
Original XGC clone length: 786

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ838938
dbEST ID: 79656640
Trimmed Sequence: ATGTGTGGGGTATCAGTGCGAGTTGTGTCCGTACTACTGACCCTCAGTGTGTGTCTGTGTTCCTCACTCCCAGAGGATTATGTGTTTCAGGCGAAGTGTCAGTGTTACTACAGGAACGGCACCGACAATATCAGGTATCTGGAAGGCTACGCTAATAATCAGGAGGAGTACGCCTACTTTGACAGTGATGTGGGGGAATATAAAGCTAAAAACGATTTTGGAGAAGTGCAGGCGAAGTATTGGAACAGCCAGAAGGAGATCCTAGAGCGGGCACGGGCTGTGGTGGATACACTCTGCAGACCCAACTATCAGCTCGGTAAACCCTTCACTGTAGACCGGAAATCTCAACCCGATGTGAAGATTGTAAACACGAAGACACTGGATTTAGAACATGAAAATCTGATAACCTGCATAGTAGATGGGTTCTTTCCTCCAATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAGGGAGAACAAGTCACATCCTCAGCATTACTAAAGAATGGAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGTGACACTTTCACCTGCCAAGTGGAGCACAGCAGCCTTCAACAACCTGTATCTGTGAACTGGGAACCAAATGTATCTGAATCTGCTCGCAATAAGAATGTGACCTGGTGTTGGTGGGCTTTGGGCTGGGATCCATCTTCCATCTAATTTGGCCTTGTAGTTTACCCACGGGAATTAAAAAAACAAGAACCCCCTTTTCAGGTGGCCAAAGGGAAGAGGGAAAGAAGGATTTGCCAAATTTTTTGGTTAAAAAAAAGTTGAGAAAAAA
Full Trace Sequence: GCACACAATAATAGATTTTATTCTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGGGGTATCAGTGCGAGTTGTGTCCGTACTACTGACCCTCAGTGTGTGTCTGTGTTCCTCACTCCCAGAGGATTATGTGTTTCAGGCGAAGTGTCAGTGTTACTACAGGAACGGCACCGACAATATCAGGTATCTGGAAGGCTACGCTAATAATCAGGAGGAGTACGCCTACTTTGACAGTGATGTGGGGGAATATAAAGCTAAAAACGATTTTGGAGAAGTGCAGGCGAAGTATTGGAACAGCCAGAAGGAGATCCTAGAGCGGGCACGGGCTGTGGTGGATACACTCTGCAGACCCAACTATCAGCTCGGTAAACCCTTCACTGTAGACCGGAAATCTCAACCCGATGTGAAGATTGTAAACACGAAGACACTGGATTTAGAACATGAAAATCTGATAACCTGCATAGTAGATGGGTTCTTTCCTCCAATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAGGGAGAACAAGTCACATCCTCAGCATTACTAAAGAATGGAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGTGACACTTTCACCTGCCAAGTGGAGCACAGCAGCCTTCAACAACCTGTATCTGTGAACTGGGAACCAAATGTATCTGAATCTGCTCGCAATAAGAATGTGACCTGGTGTTGGTGGGCTTTGGGCTGGGATCCATCTTCCATCTAATTTGGCCTTGTAGTTTACCCACGGGAATTAAAAAAACAAGAACCCCCTTTTCAGGTGGCCAAAGGGAAGAGGGAAAGAAGGATTTGCCAAATTTTTTGGTTAAAAAAAAGTTGAGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGGGGTATCAGTGCGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838937
dbEST ID: 79656639
Trimmed Sequence: ACTCATTAGATTTTCATTTTGTACCACTGAAAAGCGAGTCATAGTCTTCTTACTCCGTAGGTAAACTACAAGGCCAACTATGATGAAGATGGATCCCAGCACAAAGCCCACAATACCAGTCAACATCTTATTGCGAGCAGATTCAGATACATCTGGTTCCCAGTTCACAGATACAGGTTGTTGAAGGCTGCTGTGCTCCACTTGGCAGGTGAAAGTGTCACCATGTTTAATGGTTGTCTCCAGCATCACATGGATTTCAAATGTCCAGTCTCCATTCTTTAGTAATGCTGAGGATGTGACTTGTTCTCCCTCTTCAATCCCATTCTTCAGCCAAGTCACCTTTATCATTGGAGGAAAGAACCCATCTACTATGCAGGTTATCAGATTTTCATGTTCTAAATCCAGTGTCTTCGTGTTTACGATCTTCACATCGGGTTGAGATTTCCGGTCTACAGTGAAGGGTTTACCGAGCTGATAGTTGGGTCTGCAGAGTGTATCCACCACAGCCCCTGCCCGCTCTAGGATCTCCTTCTGGCCGTTCCCATACCTCCCCCTGCACTTCCTCCAAATCCTTTTTAGCTTTTAATTCCCCCACCCCACTTTCAAATTAGGCTAACTCCTGCGAAATAATAGCGTAGCCCTTCAGAAACCTGAAATTAGTCGGTGGCGGTCCGGGAGGTACCCCTGAGCACTTTCCCCGGGAACCCCGGGAGATCTTCCTGGGAAAAGTTAAGAAAACCGGGGACGGGGGCAGC
Full Trace Sequence: GGGGAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTCATTAGATTTTCATTTTGTACCACTGAAAAGCGAGTCATAGTCTTCTTACTCCGTAGGTAAACTACAAGGCCAACTATGATGAAGATGGATCCCAGCACAAAGCCCACAATACCAGTCAACATCTTATTGCGAGCAGATTCAGATACATCTGGTTCCCAGTTCACAGATACAGGTTGTTGAAGGCTGCTGTGCTCCACTTGGCAGGTGAAAGTGTCACCATGTTTAATGGTTGTCTCCAGCATCACATGGATTTCAAATGTCCAGTCTCCATTCTTTAGTAATGCTGAGGATGTGACTTGTTCTCCCTCTTCAATCCCATTCTTCAGCCAAGTCACCTTTATCATTGGAGGAAAGAACCCATCTACTATGCAGGTTATCAGATTTTCATGTTCTAAATCCAGTGTCTTCGTGTTTACGATCTTCACATCGGGTTGAGATTTCCGGTCTACAGTGAAGGGTTTACCGAGCTGATAGTTGGGTCTGCAGAGTGTATCCACCACAGCCCCTGCCCGCTCTAGGATCTCCTTCTGGCCGTTCCCATACCTCCCCCTGCACTTCCTCCAAATCCTTTTTAGCTTTTAATTCCCCCACCCCACTTTCAAATTAGGCTAACTCCTGCGAAATAATAGCGTAGCCCTTCAGAAACCTGAAATTAGTCGGTGGCGGTCCGGGAGGTACCCCTGAGCACTTTCCCCGGGAACCCCGGGAGATCTTCCTGGGAAAAGTTAAGAAAACCGGGGACGGGGGCAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTCATTAGATTTTCATTTTGTAC