ORFeome > LOC398189 ORF1 – XORFeome v1.0

LOC398189 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251917
Gene Page ID:
ORF Xenbase ID: 17255247

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC073332
Original XGC clone length: 2184

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11040
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ827613
dbEST ID: 79645315
Trimmed Sequence: ATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAAAATAAAAGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCCTAGGGGTGATAATCCTTACTCCAACCAGGAGAGTTAGCTATTTCCAATCACAAATGAAAATCCGCCAGCATCCCTAAAAAAGCCTGAAAGGGTCTCCGTGGTTTTTTTTACGGGAGG
Full Trace Sequence: TGTTTCAAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAAAATAAAAGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCCTAGGGGTGATAATCCTTACTCCAACCAGGAGAGTTAGCTATTTCCAATCACAAATGAAAATCCGCCAGCATCCCTAAAAAAGCCTGAAAGGGTCTCCGTGGTTTTTTTTACGGGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAATGGGGACACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ827614
dbEST ID: 79645316
Trimmed Sequence: ACGGCCCCTTCTAAACCCCCCATTTCTATTCCTGCCTCTTCCTCCGCCTCCTCGGTTTGAATTTCTGGAATTATTTCTTCTGTCAAAAGGTCTCCTCCCTCTTCCGCCAAAACCTCTATTCCTTGGTCCATCAAAGTTTCTCTCAGATTCTTGAATTGCGGGTAGTTCAGTTGCAACTGTAAACTGCCACTGTTTTGTATCTGTCCAGCGCTCCTGCATTGATTCCAGGTTTTCTGAACGAACATCAAAACACACCCCCATGGAGTCCTTGAGTAGACACATTCTATGGATTTTGGAATCAACATCATCACCCAGTTGTTCTTTAATGGATTGCCAAGCATAGCTTAAGCTGTGAATAGGTACTGAACTCTTCAATGTTATAGTCACGCAACCCGCTTCCATGTTGAGCAAAGAGCGCTGTTTAATGGACGTCGCCCCAGAAATGTGAGCTAAAGCAGCAGCTATGGCAGTTAATGCACCCTTCTGTTCAATCAGTTCCTGGGCATATTCTTTAAAATGTTCAATTACATCAGCTGGAACTGTATCCAAGGACTTTATTGCATCAGCACTGGATGATTTGGCAACATTCAATAAGGAAGGTACTCCAACACGTTTGAATGTGATTCCCGTGCTCCTCTCCACATTCCTGAGAT
Full Trace Sequence: GAAAAAAGCTATTGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGCCCCTTCTAAACCCCCCATTTCTATTCCTGCCTCTTCCTCCGCCTCCTCGGTTTGAATTTCTGGAATTATTTCTTCTGTCAAAAGGTCTCCTCCCTCTTCCGCCAAAACCTCTATTCCTTGGTCCATCAAAGTTTCTCTCAGATTCTTGAATTGCGGGTAGTTCAGTTGCAACTGTAAACTGCCACTGTTTTGTATCTGTCCAGCGCTCCTGCATTGATTCCAGGTTTTCTGAACGAACATCAAAACACACCCCCATGGAGTCCTTGAGTAGACACATTCTATGGATTTTGGAATCAACATCATCACCCAGTTGTTCTTTAATGGATTGCCAAGCATAGCTTAAGCTGTGAATAGGTACTGAACTCTTCAATGTTATAGTCACGCAACCCGCTTCCATGTTGAGCAAAGAGCGCTGTTTAATGGACGTCGCCCCAGAAATGTGAGCTAAAGCAGCAGCTATGGCAGTTAATGCACCCTTCTGTTCAATCAGTTCCTGGGCATATTCTTTAAAATGTTCAATTACATCAGCTGGAACTGTATCCAAGGACTTTATTGCATCAGCACTGGATGATTTGGCAACATTCAATAAGGAAGGTACTCCAACACGTTTGAATGTGATTCCCGTGCTCCTCTCCACATTCCTGAGAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGCCCCTTCTAAACC