ORFeome > LOC398421 ORF1 –

LOC398421 ORF1 –

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256331
Gene Page ID:
ORF Xenbase ID: 17255301

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC153771
Original XGC clone length: 1260

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ839014
dbEST ID: 79656716
Trimmed Sequence: ATGCTGAGCAGAGTCTGGACACTGAGCAGGCGCCTCTCCACCATGAGGCTCCAGTCTGATGAGTTTAACGCTTTGTTTACCGACGGGTTAAAGACACTGGCAAATCTATTCGCTAAAGACCGTTATGAGCTTCGTATAGCAGGAGGGGCTGTGAGAGATTTGCTCTCTGGAAAACAACCGCATGATGTGGATTTTGCTACCACGGCTACTCCAGAGCAGATGAAGGACATGTTTCTCAAGGACGGGGTCCGGCTGATCAATAATAAAGGCGAGACGCACGGCACTGTCACTGCCAGGATTAATGATCAGAATTTTGAGATCACGACTCTGCGGGTGGATTTGCACACAGATGGGCGACATGCTGAAGTGGAATTCACGACAGACTGGGAGATAGACGCAGAACGCCGAGACCTGACCATTAATTCCATGTTTCTGGGGTTTGATGGGACCCTCTATGATTATTTTAATGGCTATGAAGATTTGAAGAATCGTTGTGTTAGGTGTTGTGGGGGATCCATCACAGCGAATTCAGGAAGATTATCTGAGGATATTGCGCTATCTTAGGTTCTATGGAAAGATTTCAGAGCGGTCTGGTGCTCATACATCGGGCACGCTGGATGCAGTTAAGGAAAATGCATCTGGACTGAGGGGCATCTCTGGAGAACGGATCTGGTTAGAACTTATGAAAACCTTAAAGGAAATCGGGTCAACCATCTTAACCAAATTATTATTAATCTAGGATTGGCCCCAAAGGAGGGTTTACCCCAAAAGTGAAACCCTTAAAAAAATTTTCCGAAAATTCGGGAAACCCCACTCCCCCGG
Full Trace Sequence: CGGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGAGCAGAGTCTGGACACTGAGCAGGCGCCTCTCCACCATGAGGCTCCAGTCTGATGAGTTTAACGCTTTGTTTACCGACGGGTTAAAGACACTGGCAAATCTATTCGCTAAAGACCGTTATGAGCTTCGTATAGCAGGAGGGGCTGTGAGAGATTTGCTCTCTGGAAAACAACCGCATGATGTGGATTTTGCTACCACGGCTACTCCAGAGCAGATGAAGGACATGTTTCTCAAGGACGGGGTCCGGCTGATCAATAATAAAGGCGAGACGCACGGCACTGTCACTGCCAGGATTAATGATCAGAATTTTGAGATCACGACTCTGCGGGTGGATTTGCACACAGATGGGCGACATGCTGAAGTGGAATTCACGACAGACTGGGAGATAGACGCAGAACGCCGAGACCTGACCATTAATTCCATGTTTCTGGGGTTTGATGGGACCCTCTATGATTATTTTAATGGCTATGAAGATTTGAAGAATCGTTGTGTTAGGTGTTGTGGGGGATCCATCACAGCGAATTCAGGAAGATTATCTGAGGATATTGCGCTATCTTAGGTTCTATGGAAAGATTTCAGAGCGGTCTGGTGCTCATACATCGGGCACGCTGGATGCAGTTAAGGAAAATGCATCTGGACTGAGGGGCATCTCTGGAGAACGGATCTGGTTAGAACTTATGAAAACCTTAAAGGAAATCGGGTCAACCATCTTAACCAAATTATTATTAATCTAGGATTGGCCCCAAAGGAGGGTTTACCCCAAAAGTGAAACCCTTAAAAAAATTTTCCGAAAATTCGGGAAACCCCACTCCCCCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGAGCAGAGTCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839013
dbEST ID: 79656715
Trimmed Sequence: CTTATGCCCAACTCTGTTCAGCAGCTCCTCTTTACTAGTTTGAAAGCCACTTCCCTTCCAGTGTTCCTTCAGTTCCTGTAGAATTCGACCAATCTCTTTGCCAGAGGAGATACCCATACGCCGCAAATCATGGCCGCTGACTGGAAAGCGGGGCAACGTCCAGCCCTCCATCTCCCGAAAAAACTGCTCCTCGCCCTGATATTTTAGGAGCTCACATATCTTCCTGTGTGTATCCGGCTCACGTGAATCAACCACGTAATCCTTAAAAGGCTTGAGCGGCGCTGCATCTGTTCGTTCAGCTGTCAATTCTCTGCGTTGTTGTAGCAAAAACAAGGCCAAATTTTTCTCCTCCTTGGATATCTTTAACCTTAGGTCCAGTTTTTGCACATGATCCGTGTTAGAAAAAAGAGCAGTAAGGAGAGTCATCGGTTTTGGAGACATGCGGCGACTGCGTTCACAGACTCTGGCAAATTCCTCCAGGTTTCCATCTTCGGGTAAACCTACATGTGGTGCCACTCCTAGATCATAAATTATCTGGATCAGATGGTTGACATGATTTCCTTCTAGGATCTTCTTTAGTTTCACCCCGAATCCGTTCTCCAGAGATGCCCCTCCAGTCCAAATGCTTTTTCCCTAACTGGCATCCGGCGTGGCCCGATGTAAGAAACACCAAAACCCGCCTTTAAAATCCTTCCAAAAAAACCTAAAAAAAGCCCCAAAAATCCCCCAAAATAAATCCTCTCCGTAAAAATCCGTGTGTTAAATGT
Full Trace Sequence: GGGGAAAATGCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTATGCCCAACTCTGTTCAGCAGCTCCTCTTTACTAGTTTGAAAGCCACTTCCCTTCCAGTGTTCCTTCAGTTCCTGTAGAATTCGACCAATCTCTTTGCCAGAGGAGATACCCATACGCCGCAAATCATGGCCGCTGACTGGAAAGCGGGGCAACGTCCAGCCCTCCATCTCCCGAAAAAACTGCTCCTCGCCCTGATATTTTAGGAGCTCACATATCTTCCTGTGTGTATCCGGCTCACGTGAATCAACCACGTAATCCTTAAAAGGCTTGAGCGGCGCTGCATCTGTTCGTTCAGCTGTCAATTCTCTGCGTTGTTGTAGCAAAAACAAGGCCAAATTTTTCTCCTCCTTGGATATCTTTAACCTTAGGTCCAGTTTTTGCACATGATCCGTGTTAGAAAAAAGAGCAGTAAGGAGAGTCATCGGTTTTGGAGACATGCGGCGACTGCGTTCACAGACTCTGGCAAATTCCTCCAGGTTTCCATCTTCGGGTAAACCTACATGTGGTGCCACTCCTAGATCATAAATTATCTGGATCAGATGGTTGACATGATTTCCTTCTAGGATCTTCTTTAGTTTCACCCCGAATCCGTTCTCCAGAGATGCCCCTCCAGTCCAAATGCTTTTTCCCTAACTGGCATCCGGCGTGGCCCGATGTAAGAAACACCAAAACCCGCCTTTAAAATCCTTCCAAAAAAACCTAAAAAAAGCCCCAAAAATCCCCCAAAATAAATCCTCTCCGTAAAAATCCGTGTGTTAAATGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTATGCCCAACTCTGTTC