ORFeome > LOC446301 ORF1 – XORFeome v1.0

LOC446301 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251507
Gene Page ID:
ORF Xenbase ID: 17255541

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128917
Original XGC clone length: 1458

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ838972
dbEST ID: 79656674
Trimmed Sequence: ATGAATTTCCTTAGGGGAGTGATGGGAGGGCAGCAAACCTCTGGAGCTCAACAGTCCGGGACGCAGACCATCCAGAAGCTGTGTGACAGGGTTGCCTCTGCCACTCTGCTAGATGATAGAAGAGATGCTGTACGAGCCCTGAAATCCTTATCAAAGAAATATTGCTTTGAGGTGGCCACTCAAGCTATGGATCATCTTATCAATGTTCTACAGACAGACCGTTCAGATTCTGAAATTATTGGTTATGCATTGGACACTTTATACAATATAATGTCAAATGAGGCAGACGAAACAGATGAGAACCAGCAGATAGCCTCAGATGATTTAGGAGTCCAGTTTTCTGAAACATTCATTAAACAGCAAGATAATATCACCCTCCTGTTATCACTTTTGGAGGAGTTTGATTTTCATGTACGATGGCCTGGGGTAAAACTACTGACAACACTATTAAAACATCAAAGTACTCAAGTACAACAAATTGTTTTAGTAAGCCCAATGGGTGTTTCAAGACTTATGGATTTATTAGATGATTCCAGAGAGGTGATACGTAATGATGGTCTTTTGTTGCTCCAGCAACTGACTAANAGTAATGCTGCCATACAGAANATTGTTGCTTTTGAAAATGCATTTGAAAGACTTCTTGACATTATCACAGAAGAAGGAAATGGCGATGGANGCATCGTGGGTAGAGGACTGTCTTTTTGTGCTACAGAACCCTTTTGAAAGTATACAACTCAAATCAAAACTTCTTCAAAGAAGGCTCCTATATCAACGAAATGAAACCTTGGGGTTTGAAATGTGGGTGAATGGAAAATTCG
Full Trace Sequence: CTGGGTTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTTCCTTAGGGGAGTGATGGGAGGGCAGCAAACCTCTGGAGCTCAACAGTCCGGGACGCAGACCATCCAGAAGCTGTGTGACAGGGTTGCCTCTGCCACTCTGCTAGATGATAGAAGAGATGCTGTACGAGCCCTGAAATCCTTATCAAAGAAATATTGCTTTGAGGTGGCCACTCAAGCTATGGATCATCTTATCAATGTTCTACAGACAGACCGTTCAGATTCTGAAATTATTGGTTATGCATTGGACACTTTATACAATATAATGTCAAATGAGGCAGACGAAACAGATGAGAACCAGCAGATAGCCTCAGATGATTTAGGAGTCCAGTTTTCTGAAACATTCATTAAACAGCAAGATAATATCACCCTCCTGTTATCACTTTTGGAGGAGTTTGATTTTCATGTACGATGGCCTGGGGTAAAACTACTGACAACACTATTAAAACATCAAAGTACTCAAGTACAACAAATTGTTTTAGTAAGCCCAATGGGTGTTTCAAGACTTATGGATTTATTAGATGATTCCAGAGAGGTGATACGTAATGATGGTCTTTTGTTGCTCCAGCAACTGACTAANAGTAATGCTGCCATACAGAANATTGTTGCTTTTGAAAATGCATTTGAAAGACTTCTTGACATTATCACAGAAGAAGGAAATGGCGATGGANGCATCGTGGGTAGAGGACTGTCTTTTTGTGCTACAGAACCCTTTTGAAAGTATACAACTCAAATCAAAACTTCTTCAAAGAAGGCTCCTATATCAACGAAATGAAACCTTGGGGTTTGAAATGTGGGTGAATGGAAAATTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTTCCTTAGGGGAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838971
dbEST ID: 79656673
Trimmed Sequence: AAGAAGTACCTGTGAGAGAATGTTTGTGCACTGTTGAAGCAGAGATACTGGTGGGTTACCAATACTCGTAGCAAGTTGTACTCTGAGTAGTTGCTCTTTCTGGGTAGCGTTATCTAGCAGTGCATGAGCCAGTGCAACTGCTGCACACCAGTTGGAGAGTGAGTCTGTAGAAAAGAGACCTCCACACAGTAGCTGTCCAGCTGATAGCGCGTTAGCATCAATAGTAGAAGGAAGTAATGTAGCCACAATTTCTCCTTGACCTTTTTGGTTCTTGTACAAGAAGCACTGGAAGCAGTATAACACAGCACATCTCAAAACAAATGGCTGTCTTTCATTTACCATTGACATCAGCAGCACCACAATGGCAGGCCTTGGAGGGTTTGATGGAGCATTTACTGAAGCAAAGTAGTCCTGGTTAACCTGACTTCCTCTAATCACTTCAGACACAGTGTTGATTGTCTCAGTCAGGATATCTGCAGGCACCCCAGTTGCCATTAAGATAATGCAGAGTTGCTGGAGCANGCCACACTGGAACATGGACTTCTGACAACTACTAGTTGCACCAGGAGGATTTACTGGAGACACCAAGACCCGAAACAGCTGCAGCATTAAATGGAGATTTGTGACTTTCTGTGCAGACCATCCAGAATTGTCATCACCCCCTTCAAACCAAGGTTTCCTTTGTTGGGAAAAAGGAACCCTTCCTTTAAAGAATTTTTTTGATTTTGATTTTGTTATACCTTTCAAAAAGGGTTCCGGTAAC
Full Trace Sequence: AAACACGCTATAGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAAGTACCTGTGAGAGAATGTTTGTGCACTGTTGAAGCAGAGATACTGGTGGGTTACCAATACTCGTAGCAAGTTGTACTCTGAGTAGTTGCTCTTTCTGGGTAGCGTTATCTAGCAGTGCATGAGCCAGTGCAACTGCTGCACACCAGTTGGAGAGTGAGTCTGTAGAAAAGAGACCTCCACACAGTAGCTGTCCAGCTGATAGCGCGTTAGCATCAATAGTAGAAGGAAGTAATGTAGCCACAATTTCTCCTTGACCTTTTTGGTTCTTGTACAAGAAGCACTGGAAGCAGTATAACACAGCACATCTCAAAACAAATGGCTGTCTTTCATTTACCATTGACATCAGCAGCACCACAATGGCAGGCCTTGGAGGGTTTGATGGAGCATTTACTGAAGCAAAGTAGTCCTGGTTAACCTGACTTCCTCTAATCACTTCAGACACAGTGTTGATTGTCTCAGTCAGGATATCTGCAGGCACCCCAGTTGCCATTAAGATAATGCAGAGTTGCTGGAGCANGCCACACTGGAACATGGACTTCTGACAACTACTAGTTGCACCAGGAGGATTTACTGGAGACACCAAGACCCGAAACAGCTGCAGCATTAAATGGAGATTTGTGACTTTCTGTGCAGACCATCCAGAATTGTCATCACCCCCTTCAAACCAAGGTTTCCTTTGTTGGGAAAAAGGAACCCTTCCTTTAAAGAATTTTTTTGATTTTGATTTTGTTATACCTTTCAAAAAGGGTTCCGGTAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAAGTACCTGTGAGAGAATG