ORFeome > LOC446949 ORF1 – XORFeome v1.0

LOC446949 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5997629
Gene Page ID: 5997626
ORF Xenbase ID: 17255553

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC114223
Original XGC clone length: 4911

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ840249
dbEST ID: 79657951
Trimmed Sequence: ATGGCTCGTGCATCTCACACTATAAAACGGCTGCTAAGAGAATTAATAGAAATCTTTGCAGAGGATGAGAAAGCTGCTTTCCGGGAAGTTGGATCCCTTTTCCAAAATGGCCCAGATGAATATAGAAGTAAAGGTGAAACTAAGAACCCAGTTTCACAGTTTTTGAAAGCCTTTTGTGAGATATTAAAAAGTGAATTAGTCATTTCTCAGATGGAGTTGCAGTTGGTCAAATTCCGAAACGAAGCAGACGTCAGGCAGTTCTCAAATGACATTGAGTTTTTTCTCACAGAGACAGAGAAACAGATCAGATCAGAGTTTGAATCTTCCAGCACAGAATCAGTACTTGCCAAACTCCCACTGAAACCAGAGGATGTTCTGTTGAAGAGAGTGTTTGGCTGTGGGAAGCAGTGTCGCTTCTGCAAGGTCCCCTGTGAGGGTGGAGCTACTGACCATAACGAGCACTTTGCATCTGTCCATCACCCTCAAGGTTTCGGAAGTTACCGATGGATATTTAGTGACGAGTTGATATGCTGTGAATTCCGGAATTCAGAAAAAAGGTGGGTATATCACCCTTATAACAGATACCTCGGGTTGGACATGCTGTGAATTCCTGAATTATGAAACTGAATGGGAAATATCACACTTATAAAAAAAACTTCTTTTTACTCACCAAAAATGATAACATTCTGGCTTCCCACGCAGCAGTCCGGGCCTTCAAACATCGTGGGAAGTTTTCCCTTTTTAAGACTGGTTAAAAAAAGTTAGGCACAATTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCGTGCATCTCACACTATAAAACGGCTGCTAAGAGAATTAATAGAAATCTTTGCAGAGGATGAGAAAGCTGCTTTCCGGGAAGTTGGATCCCTTTTCCAAAATGGCCCAGATGAATATAGAAGTAAAGGTGAAACTAAGAACCCAGTTTCACAGTTTTTGAAAGCCTTTTGTGAGATATTAAAAAGTGAATTAGTCATTTCTCAGATGGAGTTGCAGTTGGTCAAATTCCGAAACGAAGCAGACGTCAGGCAGTTCTCAAATGACATTGAGTTTTTTCTCACAGAGACAGAGAAACAGATCAGATCAGAGTTTGAATCTTCCAGCACAGAATCAGTACTTGCCAAACTCCCACTGAAACCAGAGGATGTTCTGTTGAAGAGAGTGTTTGGCTGTGGGAAGCAGTGTCGCTTCTGCAAGGTCCCCTGTGAGGGTGGAGCTACTGACCATAACGAGCACTTTGCATCTGTCCATCACCCTCAAGGTTTCGGAAGTTACCGATGGATATTTAGTGACGAGTTGATATGCTGTGAATTCCGGAATTCAGAAAAAAGGTGGGTATATCACCCTTATAACAGATACCTCGGGTTGGACATGCTGTGAATTCCTGAATTATGAAACTGAATGGGAAATATCACACTTATAAAAAAAACTTCTTTTTACTCACCAAAAATGATAACATTCTGGCTTCCCACGCAGCAGTCCGGGCCTTCAAACATCGTGGGAAGTTTTCCCTTTTTAAGACTGGTTAAAAAAAGTTAGGCACAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCGTGCATCTCACACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837176
dbEST ID: 79654878
Trimmed Sequence: CTTATTAAACAGTTTAAAAGTAAACTTCCAGTAATCTGAGGCTGTGATGCTGGGGTGAGGCCGAACGAACCATTCTGGGTGGTAAAAGAAGTGTTCTTTATAAGGGTGATATACCCACTCAGTTTCTGAATTCCGGAATTCACAGGCATGTCCACCCGAGGTATCTTTTACAAAGTGATATTAACGATTGAATACCAATTCCAGAAGTCACAACACATGGAGTCCCCGCTAAATATCCCTCGCTAAGTTCTTAATCCTTGACAAAGATGGACATATGCCTGGTCCTCCTTAGGATCAATATCTCCCGTCTCGCAGGGAAACTTGCACATGCTACACTGCTTCACACCAGCCAACTCTCACTAGCCCATTAACATCGTGGGAGGTCAGTGGGACGTTGGGAAGTACTTATTCTGTACTGGAAGATTCAAACACTGATCTGATCTGTTNCTTTGTTCCTGCGAAAAGAAACTCANTGNNCTTGAATAACTGCTTTGAGTCGGCCTGAAATTAAGAAAGGGGACCGCCTGCNGCNCCCTCNAAAAANGGAGAAATNNNNTTTTTNAGAATNNNAGAAAAGGGGGGTNNGNNAANNTGGAGAAAGGGAGAGAAAAGATGTGCACTTTNGGTTNGNGNAAAAAAAGGGGNGAGAAAGGNNGGGANGNGNAGNNGGNNTGGCCANNAAAGNGGGGGGTGG
Full Trace Sequence: GGAACTATGCTATGGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTATTAAACAGTTTAAAAGTAAACTTCCAGTAATCTGAGGCTGTGATGCTGGGGTGAGGCCGAACGAACCATTCTGGGTGGTAAAAGAAGTGTTCTTTATAAGGGTGATATACCCACTCAGTTTCTGAATTCCGGAATTCACAGGCATGTCCACCCGAGGTATCTTTTACAAAGTGATATTAACGATTGAATACCAATTCCAGAAGTCACAACACATGGAGTCCCCGCTAAATATCCCTCGCTAAGTTCTTAATCCTTGACAAAGATGGACATATGCCTGGTCCTCCTTAGGATCAATATCTCCCGTCTCGCAGGGAAACTTGCACATGCTACACTGCTTCACACCAGCCAACTCTCACTAGCCCATTAACATCGTGGGAGGTCAGTGGGACGTTGGGAAGTACTTATTCTGTACTGGAAGATTCAAACACTGATCTGATCTGTTNCTTTGTTCCTGCGAAAAGAAACTCANTGNNCTTGAATAACTGCTTTGAGTCGGCCTGAAATTAAGAAAGGGGACCGCCTGCNGCNCCCTCNAAAAANGGAGAAATNNNNTTTTTNAGAATNNNAGAAAAGGGGGGTNNGNNAANNTGGAGAAAGGGAGAGAAAAGATGTGCACTTTNGGTTNGNGNAAAAAAAGGGGNGAGAAAGGNNGGGANGNGNAGNNGGNNTGGCCANNAAAGNGGGGGGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTATTAAACAGTTTAAAAGTA