ORFeome > LOC494794 ORF1 – XORFeome v1.0

LOC494794 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255304
Gene Page ID:
ORF Xenbase ID: 17255703

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082916
Original XGC clone length: 345

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: B11

Sequences - 5สน (forward) EST

Accession: JZ839610
dbEST ID: 79657312
Trimmed Sequence: ATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGAGCCAAAGTTTCCTCCCTGTCAGGAGTTTTCCCATAGTGATTACTCGCCCAGCGGCCAGTCTTTCAGCAGCTTTCAGCATGGGGCCCCCTACCCTCGATCCGTGTCCAACAACAACAATAACAACGCGCCCTACTCCTCCTGCCTGAGATCTGTGCGTCATGGCGCAAGGCTTCCACACTCATCTACACTTCTCCCTGGCGACAAAGCGCACGTGAAATCCCACATTACCCCCAGTCCATCCTGCAGCCTCATGTCCTCAGAGCACAAGTACCCCGACTCCCCGGAGCACGACCCAGTGTTGTT
Full Trace Sequence: TCGGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGAGCCAAAGTTTCCTCCCTGTCAGGAGTTTTCCCATAGTGATTACTCGCCCAGCGGCCAGTCTTTCAGCAGCTTTCAGCATGGGGCCCCCTACCCTCGATCCGTGTCCAACAACAACAATAACAACGCGCCCTACTCCTCCTGCCTGAGATCTGTGCGTCATGGCGCAAGGCTTCCACACTCATCTACACTTCTCCCTGGCGACAAAGCGCACGTGAAATCCCACATTACCCCCAGTCCATCCTGCAGCCTCATGTCCTCAGAGCACAAGTACCCCGACTCCCCGGAGCACGACCCAGTGTTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAAAAAAAAAAAAAAAAAAAAAAAATTTTCAGCCGTCCACGGAAAAGCCGGGGGGGAGAGAACCAAATCCTCCCCCTCCACGGGGGGGGGGGGGGGTTTCTCTGTTTTTGGGGAGAGGGAACCACCCCCGAGAAAACACACACCCTGGGCGCGCGGCTGAAAGGAATAAACACCGCCCCCCCCCACCCCGGCTCCAAAAACTAAAAAAAAAAAGGGGGGGAGGGGGGAGGGGGGGGTGTTTTTTTTTTGGTTTTTTTAAAATTTTTTTTTTTTTTGTTATCGTTTTTTTTTACCCGCCGCCCCCCCCCCCCCACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAATGAGTTCGTTTTTGATC

Sequences - 3สน (reverse) EST

Accession: JZ839609
dbEST ID: 79657311
Trimmed Sequence: CAACACTGGGTCGTGCTCCGGGGAGTCGGGGTACTTGTGCTCTGAGGACATGAGGCTGCAGGATGGACTGGGGGTAATGTGGGATTTCACGTGCGCTTTGTCGCCAGGGAGAAGTGTAGATGAGTGTGGAAGCCTTGCGCCATGACGCACAGATCTCAGGCAGGAGGAGTAGGGCGCGTTGTTATTGTTGTTGTTGGACACGGATCGAGGGTAGGGGGCCCCATGCTGAAAGCTGCTGAAAGACTGGCCGCTGGGCGAGTAATCACTATGGGAAAACTCCTGACAGGGAGGAAACTTTGGCTCCACATAGTTGGAGCTGATCAAAAACGAACTCATTCTCATGG
Full Trace Sequence: GGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAACACTGGGTCGTGCTCCGGGGAGTCGGGGTACTTGTGCTCTGAGGACATGAGGCTGCAGGATGGACTGGGGGTAATGTGGGATTTCACGTGCGCTTTGTCGCCAGGGAGAAGTGTAGATGAGTGTGGAAGCCTTGCGCCATGACGCACAGATCTCAGGCAGGAGGAGTAGGGCGCGTTGTTATTGTTGTTGTTGGACACGGATCGAGGGTAGGGGGCCCCATGCTGAAAGCTGCTGAAAGACTGGCCGCTGGGCGAGTAATCACTATGGGAAAACTCCTGACAGGGAGGAAACTTTGGCTCCACATAGTTGGAGCTGATCAAAAACGAACTCATTCTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATAAAAAAACGCAAATTACATAATAATTCACATTGCTGACTTGTGGGCACCCAGGCAAAAAATCGATCATCCAAAAATTCCGAGGTACTTTTTTCTGTTTTTTTTTGAGAAAGCTGTACCCGCAACAACCACCTGCCCCGGGACAGAATTGACGTTGTAAATATGGCGGCGGCGTGTGGGGCTAACCATTTCGGACAAACCCTTTGGAAACCCCACCGGGGGGGTTCTGCGGGGCTTGTTGTTTGTTTTTTTTGGGGTTAATTTATTATTCTGGGTGGAGCCAAACACCCCCCCCTCTCCCCCCCGGGCGCGATATTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACACTGGGTCGTGCT