ORFeome > LOC495170 ORF1 – XORFeome v1.0

LOC495170 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6254302
Gene Page ID:
ORF Xenbase ID: 17255931

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084382
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: B12

Sequences - 5สน (forward) EST

Accession: JZ839990
dbEST ID: 79657692
Trimmed Sequence: ATGAAGATCATCGTGGGCATCGGAGGTGTAACCAATGGAGGAAAGACAACCCTCACCAACAAACTGATTAACACCTTGCCAAACTGCTGTGTGGTACACCAGGATGATTTTTTCAAGCCCCAAGACAAGATAGAAGTTCAAGATGGATTCAAACAGTATGATGTTATCACAGCCTTAGATATGGAAGCTATGATGAGTACGATTGATGGCTGGTGGAAAGATCCTGCTAAATTTGAGCGCTCGCATGGGATCAACAATGCATTAGACTCCGAGACACCACAAGATACCGAGAACCATGAAAGCCTTCATATTCTTATTGTAGAAGGATTTCTCCTTTACACCTACAAACCACTTATTGATCTGTTCACCAAATGCTATTTTCTTTCTGTACCCTATGATGAATGCAAGAGTCGAAGGAGCTCAAGAAACTATACCGTTCCAGATCCACCGGGACTGTTTGATGGCCATGTCTGGCCTATGTACATAAAGCACAAACATATAATGGAAGAATTAAATGTTAATGTCGAGCAACTGGATGGGACAAATACCAAGGAAGAATTGTTCAACAGAGTGTATGGTGACATGCTGGATCTTATAAACAGCAAAGAATTT
Full Trace Sequence: CGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGATCATCGTGGGCATCGGAGGTGTAACCAATGGAGGAAAGACAACCCTCACCAACAAACTGATTAACACCTTGCCAAACTGCTGTGTGGTACACCAGGATGATTTTTTCAAGCCCCAAGACAAGATAGAAGTTCAAGATGGATTCAAACAGTATGATGTTATCACAGCCTTAGATATGGAAGCTATGATGAGTACGATTGATGGCTGGTGGAAAGATCCTGCTAAATTTGAGCGCTCGCATGGGATCAACAATGCATTAGACTCCGAGACACCACAAGATACCGAGAACCATGAAAGCCTTCATATTCTTATTGTAGAAGGATTTCTCCTTTACACCTACAAACCACTTATTGATCTGTTCACCAAATGCTATTTTCTTTCTGTACCCTATGATGAATGCAAGAGTCGAAGGAGCTCAAGAAACTATACCGTTCCAGATCCACCGGGACTGTTTGATGGCCATGTCTGGCCTATGTACATAAAGCACAAACATATAATGGAAGAATTAAATGTTAATGTCGAGCAACTGGATGGGACAAATACCAAGGAAGAATTGTTCAACAGAGTGTATGGTGACATGCTGGATCTTATAAACAGCAAAGAATTTGCCACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCCTATCAATTTGTTGCACCGAACAGGTCACTATCAGTCCAAATAAAATCATTAATTTGCCATTCCGCTTAATAATCCCCTATTATTGAGTCCTAAAAAAAAAAAAAAAAAAAAAATATACTGAGCACCCTCCGGGCCCCGTTGTCTAAAAGCTCTCCCTAAAATTATAAACAAAANCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGATCATCGTGGGCATCGG

Sequences - 3สน (reverse) EST

Accession: JZ839989
dbEST ID: 79657691
Trimmed Sequence: TTCCTTGCTGTTTATAAGATCCAGCATGTCACCATACACTCTGTTGAACAATTCTTCCCTGGTATTTGTCCCATCCAGTTGCTCGACATTAACATTTAATTCTTCCATTATATGTTTGTGCTTTATGTACATAGGCCAGACATGGCCATCAAACAGTCCCGGTGGATCTGGAACGGTATAGTTTCTTGAGCTCCTTCGACTCTTGCATTCATCATAGGGTACAGAAAGAAAATAGCATTTGGTGAACAGATCAATAAGTGGTTTGTAGGTGTAAAGGAGAAATCCTTCTACAATAAGAATATGAAGGCTTTCATGGTTCTCGGTATCTTGTGGTGTCTCGGAGTCTAATGCATTGTTGATCCCATGCGAGCGCTCAAATTTAGCAGGATCTTTCCACCAGCCGTCAGTCGTACTCATCATAGCTTCCATATCTAAAGCTGTGATAACATCATACTGTTTGAATCCATCTTGAACTTCCATCTAGTCTTGGGGCTTGAGAAAATCCATCCTGGTGTACGACACAACAAGTTGGGCGAGGGTGTGAATCAGTTTTGTTGGGGGAGGGTTGGTCTTTCTTCCATTGCGTACACCGTCGCATGCCCAACAAAGATCTTCATGGTTCCCAACTTTGAATAGTACAGGTTGGGCATTATAAAAAAACAATTGCTTAACCATTTATTTACAAACAATATGGTAGATTATTGGGTAAAAAAATAAAAAAAAATAAATAAAAAAACACAAATTATAACCATCTAACCAGACGAATAACAAAAAACATCTAATAAACATATAGATA
Full Trace Sequence: AAGAGGGCTATGGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTTGCTGTTTATAAGATCCAGCATGTCACCATACACTCTGTTGAACAATTCTTCCCTGGTATTTGTCCCATCCAGTTGCTCGACATTAACATTTAATTCTTCCATTATATGTTTGTGCTTTATGTACATAGGCCAGACATGGCCATCAAACAGTCCCGGTGGATCTGGAACGGTATAGTTTCTTGAGCTCCTTCGACTCTTGCATTCATCATAGGGTACAGAAAGAAAATAGCATTTGGTGAACAGATCAATAAGTGGTTTGTAGGTGTAAAGGAGAAATCCTTCTACAATAAGAATATGAAGGCTTTCATGGTTCTCGGTATCTTGTGGTGTCTCGGAGTCTAATGCATTGTTGATCCCATGCGAGCGCTCAAATTTAGCAGGATCTTTCCACCAGCCGTCAGTCGTACTCATCATAGCTTCCATATCTAAAGCTGTGATAACATCATACTGTTTGAATCCATCTTGAACTTCCATCTAGTCTTGGGGCTTGAGAAAATCCATCCTGGTGTACGACACAACAAGTTGGGCGAGGGTGTGAATCAGTTTTGTTGGGGGAGGGTTGGTCTTTCTTCCATTGCGTACACCGTCGCATGCCCAACAAAGATCTTCATGGTTCCCAACTTTGAATAGTACAGGTTGGGCATTATAAAAAAACAATTGCTTAACCATTTATTTACAAACAATATGGTAGATTATTGGGTAAAAAAATAAAAAAAAATAAATAAAAAAACACAAATTATAACCATCTAACCAGACGAATAACAAAAAACATCTAATAAACATATAGATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTGCTGTTTATAAGATCCAG