ORFeome > LOC495270 ORF1 – XORFeome v1.0

LOC495270 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6254105
Gene Page ID:
ORF Xenbase ID: 17256021

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084369
Original XGC clone length: 651

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: F11

Sequences - 5สน (forward) EST

Accession: JZ840040
dbEST ID: 79657742
Trimmed Sequence: ATGCTGCGGCCATTGGAGAGAAACATGAAGCTATTGTTGGCTGCTGCGCTCATCGCGGGCTCCGTCATATTCCTGCTCTTCCCTGGGAGCTCCGTAGCTGATGAGAAGAAGAAAGGGCCGAAGGTGACCGAGAAGGTGTACTTTAATATAAAGATCGGAGATGAGGATGTAGGACGTATAGTAATCGGTCTTTTTGGAAAAACTGTTCCCAAGACGGTTGAAAATTTTGTAACCTTGGCAACAGGGGAGAAAGGATTTGGTTACCAAGGCAGCAAGTTCCACCGTGTCATCAAAGACTTTATGATACAAGGAGGAGATTTTACTCGTGGAGATGGTACCGGAGGAAAAAGCATTTATGGAGAAAAGTTTTCAGATGAGAACTTCAAGCTAAAGCACTATGGCCCATATTGGCTTAGTATGGCTAATGCTGGAAAAGACACTAATGGTTCCCAGTTCTTCATAACAACTGTCAAGACTCCATGGCTTGATGGGAAACATGTTGTGTTTGGCAAAATTCTGGAAGGCATGGATGTTGTGCGAAAGATTGAATCCACTAAAACAGATGGTCGGGATAAACCAATTAAAGATGTGGTCATTGCAGAGTGTGGAAAGAACAAGGTAGAAAAACAATTTGCAATTGCCCAAGAGTT
Full Trace Sequence: CGCGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGCGGCCATTGGAGAGAAACATGAAGCTATTGTTGGCTGCTGCGCTCATCGCGGGCTCCGTCATATTCCTGCTCTTCCCTGGGAGCTCCGTAGCTGATGAGAAGAAGAAAGGGCCGAAGGTGACCGAGAAGGTGTACTTTAATATAAAGATCGGAGATGAGGATGTAGGACGTATAGTAATCGGTCTTTTTGGAAAAACTGTTCCCAAGACGGTTGAAAATTTTGTAACCTTGGCAACAGGGGAGAAAGGATTTGGTTACCAAGGCAGCAAGTTCCACCGTGTCATCAAAGACTTTATGATACAAGGAGGAGATTTTACTCGTGGAGATGGTACCGGAGGAAAAAGCATTTATGGAGAAAAGTTTTCAGATGAGAACTTCAAGCTAAAGCACTATGGCCCATATTGGCTTAGTATGGCTAATGCTGGAAAAGACACTAATGGTTCCCAGTTCTTCATAACAACTGTCAAGACTCCATGGCTTGATGGGAAACATGTTGTGTTTGGCAAAATTCTGGAAGGCATGGATGTTGTGCGAAAGATTGAATCCACTAAAACAGATGGTCGGGATAAACCAATTAAAGATGTGGTCATTGCAGAGTGTGGAAAGAACAAGGTAGAAAAACAATTTGCAATTGCCCAAGAGTTGCCAAACTTTCTTGTACAAGTTGGCATTATAAGAAAGCATTGCTATATAAGTTGTTTGCAACCAAAAGGTTACTATTATTTAAAAAAAAATCATTAATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCGGCCATTGGA

Sequences - 3สน (reverse) EST

Accession: JZ840039
dbEST ID: 79657741
Trimmed Sequence: CTCTTTGGCAATTGCAAATGGCTTTTCTACCTCGATCTTTCCACATTCTGCAATGACCACATCTTTAATTGGTTTATCCCGACCATCTGTTTTAGTGGATTCAATCTTTCGCACAACATCCATGCCTTCCAGAATTTTGCCAAACACAACATGTTTCCCATCAAGCCATGGAGTCTTGACAGTTGTTATGAAGAACTGGGAACCATTAGTGTCTTTTCCAGCATTAGCCATACTAAGCCAATATGGGCCATAGTGCTTTAGCTTGAAGTTCTCATCTGAAAACTTTTCTCCATAAATGCTTTTTCCTCCGGTACCATCTCCACGAGTAAAATCTCCTCCTTGTATCATAAAGTCTTTGATGACACGGTGGAACTTGCTGCCTTGGTAACCAAATCCTTTCTCCCCTGTTGCCAAGGTTACAAAATTTTCAACCGTCTTGGGAACAGTTTTTCCAAAAAGACCGATTACTATACGTCCTACATCCTCATCTCCCATCTTTATATTAAAGTACACCTTCTCGGTCACCTTCGGCCCTTTCTTCTTCTCATCAGCTACAGAGCTCCCAGGGAAGAGCAGGAAAATGACGGAACCCGCGATGAGCGCACCAGCCCACAATAACTTCATGTTTCTCGTCAATGGCCGCAGCCAGGGGCCCAATTTTTTTGAACAAGTTGGCATTATAAAAAAACAATGACACAAACATTTTT
Full Trace Sequence: GAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTTGGCAATTGCAAATGGCTTTTCTACCTCGATCTTTCCACATTCTGCAATGACCACATCTTTAATTGGTTTATCCCGACCATCTGTTTTAGTGGATTCAATCTTTCGCACAACATCCATGCCTTCCAGAATTTTGCCAAACACAACATGTTTCCCATCAAGCCATGGAGTCTTGACAGTTGTTATGAAGAACTGGGAACCATTAGTGTCTTTTCCAGCATTAGCCATACTAAGCCAATATGGGCCATAGTGCTTTAGCTTGAAGTTCTCATCTGAAAACTTTTCTCCATAAATGCTTTTTCCTCCGGTACCATCTCCACGAGTAAAATCTCCTCCTTGTATCATAAAGTCTTTGATGACACGGTGGAACTTGCTGCCTTGGTAACCAAATCCTTTCTCCCCTGTTGCCAAGGTTACAAAATTTTCAACCGTCTTGGGAACAGTTTTTCCAAAAAGACCGATTACTATACGTCCTACATCCTCATCTCCCATCTTTATATTAAAGTACACCTTCTCGGTCACCTTCGGCCCTTTCTTCTTCTCATCAGCTACAGAGCTCCCAGGGAAGAGCAGGAAAATGACGGAACCCGCGATGAGCGCACCAGCCCACAATAACTTCATGTTTCTCGTCAATGGCCGCAGCCAGGGGCCCAATTTTTTTGAACAAGTTGGCATTATAAAAAAACAATGACACAAACATTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTTGGCAATTGCAAATGGCT