ORFeome > LOC495361 ORF1 – XORFeome v1.0

LOC495361 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 5738373
Gene Page ID: 5738363
ORF Xenbase ID: 17256081

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084825
Original XGC clone length: 450

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ840026
dbEST ID: 79657728
Trimmed Sequence: ATGAGGCAACAAGCAAAAACTTTGTGGTACGACCGAGCAAAATATGTGTTTTTGGAGTTCTGTGTCGAAAACAGTCGGGATGTCAAGGTGGACATCAAGAAAGATAAGGTTATCTTCAGCTGTTTAAATGAAGATAACATACAAATATACAATGAAATCCAGTTATATGACAAAGTGCAGCCCTTGGATTCCAGGGAAAAGCGCTCAGATCGATCAATAACCTGCTTCTTGAGGAAATGTAAAGAGAAGGTGGCCTGGCCCAGGATAACAAAGGAAAATACCAAGCCCGCTTGGCTGTTTGTAGATTTCGATAACTGGAGAGACTGGGATGCCGAAAAGGAAGGGGAAATGGCACTGGCTGAACATTATCTAAATCTCGTCAATGGTTGCAAGGATAAAGTGGCTCCTCCGAGCATGGATGACTTGGATGATTTAGATGATGATTTGTT
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGCAACAAGCAAAAACTTTGTGGTACGACCGAGCAAAATATGTGTTTTTGGAGTTCTGTGTCGAAAACAGTCGGGATGTCAAGGTGGACATCAAGAAAGATAAGGTTATCTTCAGCTGTTTAAATGAAGATAACATACAAATATACAATGAAATCCAGTTATATGACAAAGTGCAGCCCTTGGATTCCAGGGAAAAGCGCTCAGATCGATCAATAACCTGCTTCTTGAGGAAATGTAAAGAGAAGGTGGCCTGGCCCAGGATAACAAAGGAAAATACCAAGCCCGCTTGGCTGTTTGTAGATTTCGATAACTGGAGAGACTGGGATGCCGAAAAGGAAGGGGAAATGGCACTGGCTGAACATTATCTAAATCTCGTCAATGGTTGCAAGGATAAAGTGGCTCCTCCGAGCATGGATGACTTGGATGATTTAGATGATGATTTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAATTGATCTTATTAAATGGTCCAAGCTGGTTTCCTAAAAAAAAAAAGAAAGAAGTTTAAAATCTCACTCGGTCCAGCCCGCCGACAAAAAAGCCGACCCCTCCCCCCCCCAAAGGGGGCCGTGTTTGACACCTGGGTTTCGCGGAAAGGCCCAACACAACAAAAATAACACCGGGCGGGGTATAAAATATTGGGGAGAACGGGGCGGCGGCGGCCACCACGGCGGCAAATAAAAGTAAAAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGCAACAAGCAAAAACTTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ840025
dbEST ID: 79657727
Trimmed Sequence: CAAATCATCATCTAAATCATCCAAGTCATCCATGCTCGGAGGAGCCACTTTATCCTTGCAACCATTGACGAGATTTAGATAATGTTCAGCCAGTGCCATTTCCCCTTCCTCTTCGGCATCCCAGTCTCTCCAGTTATCGAAATCTACAAACAGCCAAGCGGGCTTGGTATTTTCCTTTGTTATCCTGGGCCAGGCCACCTTCTCTTTACATTTCCTCAAGAAGCAGGTTATTGATCGATCTGAGCGCTTTTCCCTGGAATCCAAGGGCTGCACTTTGTCATATAACTGGATTTCATTGTATATTTGTATGTTATCTTCATTTAAACAGCTGAAGATAACCTTATCTTTCTTGATGTCCACCTTGACATCCCGACTGTTTTCGACACAGAACTCCAAAAACACATATTTTGCTCGGTCGTACCACAAAGTTTTTGCTTGTTGCCTCATGG
Full Trace Sequence: AAGACGGCTAATGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAATCATCATCTAAATCATCCAAGTCATCCATGCTCGGAGGAGCCACTTTATCCTTGCAACCATTGACGAGATTTAGATAATGTTCAGCCAGTGCCATTTCCCCTTCCTCTTCGGCATCCCAGTCTCTCCAGTTATCGAAATCTACAAACAGCCAAGCGGGCTTGGTATTTTCCTTTGTTATCCTGGGCCAGGCCACCTTCTCTTTACATTTCCTCAAGAAGCAGGTTATTGATCGATCTGAGCGCTTTTCCCTGGAATCCAAGGGCTGCACTTTGTCATATAACTGGATTTCATTGTATATTTGTATGTTATCTTCATTTAAACAGCTGAAGATAACCTTATCTTTCTTGATGTCCACCTTGACATCCCGACTGTTTTCGACACAGAACTCCAAAAACACATATTTTGCTCGGTCGTACCACAAAGTTTTTGCTTGTTGCCTCATGGTGCCAACTTTTTTAAACCAAATTGGGATTATAAAAAAGCATTGCTCATCAATTTGTTGCTACGAACAGGGTCCTATCAGTCAAAATAAAATCATTATTTTGGGTCCCAAAAAAAAAAATAGAACTAATTTAATAACTACGTCACAAGGGCCCGGGAACAAAAATGCCAACGCCCATCGAACCAAGGGGGCTTGGGGTCCCTTTCTTGGAAGGGGAAAGGCACAAACAAAGAAAACTTACCCGGGTGGGGGTGAAAACTAGGGAGAAAAGAGCGAGGGGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAATCATCATCTAAATCATC