ORFeome > LOC495365 ORF1 – XORFeome v1.0

LOC495365 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6253960
Gene Page ID:
ORF Xenbase ID: 17256087

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC084829
Original XGC clone length: 753

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ840038
dbEST ID: 79657740
Trimmed Sequence: ATGTTGGCTGGGGTGCGGGCGGCCCGCGGGCTTTTCAGGGGAGCAACTGCTTTCTGCTCACTTCCACAAGTCCGACTGGAGGGCACGACGACAGAGTCAAGACCTACAGTGAGGCCAGAAAGCAAAGTGCTGCTGAACCAACTCTCGGCCTTCGGGGAGTATGTGGCGGAGATCATGCCCAAGTATGTGCAGCAAGTTCAGGTGACCTGTAACGGAGAACTGGAGGTCATGGTTCACCCGGATGGCGTTATACCAGTCCTTGTATTTCTTCGTGACCACACAAACGCCCAGTTCAAATCACTGGCCGACCTGACTGCTGTCGATATCCCGGCGAGAACAAACCGCTTTGAAATCGTTTACAACCTTTTGTCATTGCGGTTCAACAGCCGCATGCGAGTGAAGACCTACGCTGATGAACTGACTCCTATTGAGTCCGCTGTGCCCGTCTTCCAGGCTGCAAACTGGTATGAGAGAGAGGTTTGGGATATGTATGGGTGTGTTTTTCGCATACCACCCTGATCTGAGAAGGATCCTAACAGACTATGGGTTTGAAGGGCATCCCTTCCGGAAAGATTTCCCACTGTCTGGATATGTGGAGGTGCGCTATGATGATGAGGTGAAACGAATGGTGGCGGAGCCCGTGCAGCTGTCCCAAGAAATTCCGCAGGTTTGATCTGAGCAGCCCATGGGAAAGCCTTTCCAGCACATCGTCAGCCAACCTGAAAGCCCAAAAAC
Full Trace Sequence: GGCCCCCAATAATAGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGCTGGGGTGCGGGCGGCCCGCGGGCTTTTCAGGGGAGCAACTGCTTTCTGCTCACTTCCACAAGTCCGACTGGAGGGCACGACGACAGAGTCAAGACCTACAGTGAGGCCAGAAAGCAAAGTGCTGCTGAACCAACTCTCGGCCTTCGGGGAGTATGTGGCGGAGATCATGCCCAAGTATGTGCAGCAAGTTCAGGTGACCTGTAACGGAGAACTGGAGGTCATGGTTCACCCGGATGGCGTTATACCAGTCCTTGTATTTCTTCGTGACCACACAAACGCCCAGTTCAAATCACTGGCCGACCTGACTGCTGTCGATATCCCGGCGAGAACAAACCGCTTTGAAATCGTTTACAACCTTTTGTCATTGCGGTTCAACAGCCGCATGCGAGTGAAGACCTACGCTGATGAACTGACTCCTATTGAGTCCGCTGTGCCCGTCTTCCAGGCTGCAAACTGGTATGAGAGAGAGGTTTGGGATATGTATGGGTGTGTTTTTCGCATACCACCCTGATCTGAGAAGGATCCTAACAGACTATGGGTTTGAAGGGCATCCCTTCCGGAAAGATTTCCCACTGTCTGGATATGTGGAGGTGCGCTATGATGATGAGGTGAAACGAATGGTGGCGGAGCCCGTGCAGCTGTCCCAAGAAATTCCGCAGGTTTGATCTGAGCAGCCCATGGGAAAGCCTTTCCAGCACATCGTCAGCCAACCTGAAAGCCCAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGCTGGGGTGCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ840037
dbEST ID: 79657739
Trimmed Sequence: TTTGGCTTCTCCGGGCTCCAGTTTTGGGCTTTCAGGCTGCTGACGATGTGCTGGAAAGGCTTCCCATGGGCTGCTCAGATCAAACTTGCGGAACTCCTGGGACAGCTGCACGGGCTCCGCCACCACTCGTTTCACCTCATCATCATAGCGCACCTCCACATATCCNGACAGTGGGAAATCTTTCCGGAAGGGATGCCCTTCAAACCCATAGTCTGTTAGGATCCTTCTCAGATCAGGGTGGTTTGCGAAAAACACACCATACATATCCCAAACCTCTCTCTCATACCAGTTTGCAGCCTGGAAGACGGGCACAGCGGACTCAATAGGAGTCAGTTCATCAGCGTAGGTCTTCACTCGCATGCGGCTGTTGAACCGCAATGACAAAAGGTTGTAAACGATTTCAAAGCGGTTTGTTCTCGCCGGGATATCGACAGCAGTCAGGTCGGCCAGTGATTTGAACTGGGCGTTTGTGTGGTCACGAAGAANTACAAGGACTGGTATAACGCCATCCGGGTGAACCATGACCTCCATTTCTCCGTTAAAGGTCACCTGAACTTGCTGCACATACGTGGGCATGATCTCCGCCCAATACTCCCAAAAAGGCAAAAATTTGGTTCACAACACTTTGCTTTTTCGGCTCCCTGTAAAGTCT
Full Trace Sequence: GAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGGCTTCTCCGGGCTCCAGTTTTGGGCTTTCAGGCTGCTGACGATGTGCTGGAAAGGCTTCCCATGGGCTGCTCAGATCAAACTTGCGGAACTCCTGGGACAGCTGCACGGGCTCCGCCACCACTCGTTTCACCTCATCATCATAGCGCACCTCCACATATCCNGACAGTGGGAAATCTTTCCGGAAGGGATGCCCTTCAAACCCATAGTCTGTTAGGATCCTTCTCAGATCAGGGTGGTTTGCGAAAAACACACCATACATATCCCAAACCTCTCTCTCATACCAGTTTGCAGCCTGGAAGACGGGCACAGCGGACTCAATAGGAGTCAGTTCATCAGCGTAGGTCTTCACTCGCATGCGGCTGTTGAACCGCAATGACAAAAGGTTGTAAACGATTTCAAAGCGGTTTGTTCTCGCCGGGATATCGACAGCAGTCAGGTCGGCCAGTGATTTGAACTGGGCGTTTGTGTGGTCACGAAGAANTACAAGGACTGGTATAACGCCATCCGGGTGAACCATGACCTCCATTTCTCCGTTAAAGGTCACCTGAACTTGCTGCACATACGTGGGCATGATCTCCGCCCAATACTCCCAAAAAGGCAAAAATTTGGTTCACAACACTTTGCTTTTTCGGCTCCCTGTAAAGTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGCTTCTCCGGGCT