ORFeome > LOC495385 ORF1 – XORFeome v1.0

LOC495385 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6253954
Gene Page ID:
ORF Xenbase ID: 17256111

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084853
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ839995
dbEST ID: 79657697
Trimmed Sequence: ATGGTGTGCGGAGGCTTCACCTGCTCCAAGAACTCCCTGTGTGTGCTGAACCTGCTCTATATTATGGTCAGCCTGCTGCTGATCGGAGTTGCAGCCTGGGGAATAGGATTTGGCCTCGTTTCCAGTTTGCGAGTGGTTGGCGTCGCCGTTGCTGTTGGAATCCTACTATTTCTCATTGCTCTGGTTGGGCTCATTGGAGCAATTAAACATCACCAGGTGTTACTGTTTTTTTACATGATCATCCTATTTTTGGTCTTCGTTGTACAGTTTTCGGTATCGTGCGCATCTCTGGCCTTAAACAGTGATCAGCAGAAACAACTTTTGGAAGTCGGCTGGAACCATACAAATGGAGCTCATACTGATATTGAAAGGAGCCTGAACTGTTGTGGATTTAAAACCTATTCTCAAAATGACACCTGTGGAGCTACCTGCACACAGGGTTGCCATCCATGTGGTCCAATAATTGAAAAACATGCAGAAGAAGTGCTAAGAGTTGTGGGAGGAATTGGTTTTTTCTTCAGCTTTACCGAGATTCTTGGAATTTGGCTGACTTACAGATACAGAACCCAAAAGACCCAAAAGCAAACCCCCAGGCATTTTCTTTTGCA
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGTGCGGAGGCTTCACCTGCTCCAAGAACTCCCTGTGTGTGCTGAACCTGCTCTATATTATGGTCAGCCTGCTGCTGATCGGAGTTGCAGCCTGGGGAATAGGATTTGGCCTCGTTTCCAGTTTGCGAGTGGTTGGCGTCGCCGTTGCTGTTGGAATCCTACTATTTCTCATTGCTCTGGTTGGGCTCATTGGAGCAATTAAACATCACCAGGTGTTACTGTTTTTTTACATGATCATCCTATTTTTGGTCTTCGTTGTACAGTTTTCGGTATCGTGCGCATCTCTGGCCTTAAACAGTGATCAGCAGAAACAACTTTTGGAAGTCGGCTGGAACCATACAAATGGAGCTCATACTGATATTGAAAGGAGCCTGAACTGTTGTGGATTTAAAACCTATTCTCAAAATGACACCTGTGGAGCTACCTGCACACAGGGTTGCCATCCATGTGGTCCAATAATTGAAAAACATGCAGAAGAAGTGCTAAGAGTTGTGGGAGGAATTGGTTTTTTCTTCAGCTTTACCGAGATTCTTGGAATTTGGCTGACTTACAGATACAGAACCCAAAAGACCCAAAAGCAAACCCCCAGGCATTTTCTTTTGCAACTTTCTTGTACAAGGTTGGATTATAAGAAAGCATTGCTTATCAATTTTTTGCGAACAAACGGGTCCCAATAATTCAAAATAAATCCATTATTGGCATTCCCCCTGATATCCCCTTTAGTGAGTCCAATTACATGGGAAAAAACAGATTAAAAAAAAAAAATAACCACGGGGTCCCAAATCCCCTTGAGTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTGCGGAGGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839994
dbEST ID: 79657696
Trimmed Sequence: AAGAAATGCACTGGGGTTTGCTCTTGGGTCCTTTTGGTTTCTGTATCTGTAAGTCAGCCAAACTCCAAGAATCTCGGTAAAGCTGAAGAAAAAACCAATTCCTCCCACAACTCTTAGCACTTCTTCTGCATGTTTTTCAATTATTGGACCACATGGATGGCAACCCTGTGTGCAGGTAGCTCCACAGGTGTCATTTTGAGAATAGGTTTTAAATCCACAACAGTTCAGGCTCCTTTCAATATCAGTATGAGCTCCATTTGTATGGTTCCAGCCGACTTCCAAAAGTTGTTTCTGCTGATCACTGTTTAAGGCCAGAGATGCGCACGATACCGAAAACTGTACAACGAAAACCAAAAATAGGATGATCATGTAAAAAAACAGTAACACCTGGTGATGTTTAATTGCTCCAATGAGCCCAACCAAAGCAATGAGAAATAGTAGGATTCCAACAGCAACGGCGACGCCAACCACTCGCAAACTGTACACGAGGCCCAATCCTATTCCCCAGGCTGCAACTCCGATCAACAGCAGGCTGACCATAATATAAAGCAGGTTCAACACCCACGGGAACTTTCTGCAGCAGGTTAAGCCTCCGCACACCCTGG
Full Trace Sequence: GGCACTAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAAATGCACTGGGGTTTGCTCTTGGGTCCTTTTGGTTTCTGTATCTGTAAGTCAGCCAAACTCCAAGAATCTCGGTAAAGCTGAAGAAAAAACCAATTCCTCCCACAACTCTTAGCACTTCTTCTGCATGTTTTTCAATTATTGGACCACATGGATGGCAACCCTGTGTGCAGGTAGCTCCACAGGTGTCATTTTGAGAATAGGTTTTAAATCCACAACAGTTCAGGCTCCTTTCAATATCAGTATGAGCTCCATTTGTATGGTTCCAGCCGACTTCCAAAAGTTGTTTCTGCTGATCACTGTTTAAGGCCAGAGATGCGCACGATACCGAAAACTGTACAACGAAAACCAAAAATAGGATGATCATGTAAAAAAACAGTAACACCTGGTGATGTTTAATTGCTCCAATGAGCCCAACCAAAGCAATGAGAAATAGTAGGATTCCAACAGCAACGGCGACGCCAACCACTCGCAAACTGTACACGAGGCCCAATCCTATTCCCCAGGCTGCAACTCCGATCAACAGCAGGCTGACCATAATATAAAGCAGGTTCAACACCCACGGGAACTTTCTGCAGCAGGTTAAGCCTCCGCACACCCTGGTGGCCACTTTTTTGTACAAAGTTTGGCATTATAAAAAAACTTTGCTCATCAATTTTTTGCAACCAACAGGTCACTTATTAGGTCCNATTTNAATTCATTAATATAAACAAACAAAAAAAAAAAAAAAAAGACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAAATGCACTGGGGTTTG