ORFeome > LOC495397 ORF1 – XORFeome v1.0

LOC495397 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253949
Gene Page ID:
ORF Xenbase ID: 17256123

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128677
Original XGC clone length: 1941

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ838208
dbEST ID: 79655910
Trimmed Sequence: ATGGCAGGGGATGCTCTAATGCTGGTGAGAGGCCTGGCCAAGCTCAGCAAGGCTGTACTAGAGGTGCAGGCAGGGCAGATGCACCAGCCAACACTTGGCATAAATGGCATTGGATTTGCCAGAAGCTGGCAGGTGGCGGTAGAAGAACGTTTCAGTGCTGCTATGGGAAAGATGCAGGAGCTGGGCAAGCAGCAAGAGAACCTTGCTGGGCAGGATATTGAGACAGAATACAACTTATATGGGCCAACATCAGAGATTGCTGGCATGGAGTATTCCCCGTCTTCCAGCCAGACTCAGGAATTGCACCACAGTGAGGTTGATGCACAGAGCAATGATGCATCTTACAGGGGTCAGGGGCAAACAGGCAGCTCTTTCCATCCTGACCTGTCGGTTGAAAGGGACAATGGGGCCTTATTTGGAAATGTCCGTGACAGTGCCGGACCTTTTGCAGCATACAGCCAAAAAAGCAAATAGCAATCCATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGGATGCTCTAATGCTGGTGAGAGGCCTGGCCAAGCTCAGCAAGGCTGTACTAGAGGTGCAGGCAGGGCAGATGCACCAGCCAACACTTGGCATAAATGGCATTGGATTTGCCAGAAGCTGGCAGGTGGCGGTAGAAGAACGTTTCAGTGCTGCTATGGGAAAGATGCAGGAGCTGGGCAAGCAGCAAGAGAACCTTGCTGGGCAGGATATTGAGACAGAATACAACTTATATGGGCCAACATCAGAGATTGCTGGCATGGAGTATTCCCCGTCTTCCAGCCAGACTCAGGAATTGCACCACAGTGAGGTTGATGCACAGAGCAATGATGCATCTTACAGGGGTCAGGGGCAAACAGGCAGCTCTTTCCATCCTGACCTGTCGGTTGAAAGGGACAATGGGGCCTTATTTGGAAATGTCCGTGACAGTGCCGGACCTTTTGCAGCATACAGCCAAAAAAGCAAATAGCAATCCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATATTGAGTCGTAATACATGGGTCATAGCTGTTACAAAAAAACCACTGGGCCTTGTCTCAAAAACTCCTAAGTATCAAAAAGCAATNTTCTTGGGTTGGTTCTATCCCCTCCAAAGTATGGTGTTAGGTACTCCACGTTGATTCAAAAAAAGTCTCCGCGGTTTTACAAAAAAAAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGGATGCTCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838207
dbEST ID: 79655909
Trimmed Sequence: TGGATTGCTATTTGCTTTTTTGGCTGTATGCTGCCCCAGGTCCGGCACTGTCACGGACATTTCCAAATAAGGCCCCATTGTCCCTTTCAACCGACAGGTCAGGATGGAAAGAGCTGCCTGTTTGCCCCTGACCCCTGTAAGATGCATCATTGCTCTGTGCATCAACCTCACTGTGGTGCAATTCCTGAAACAGGCTGGAAAAAAGGGAATACTCCATGCCAGCAATCTCTGAAGCTGGCCCAGAGAAGTTGTATTCTGTCTCAATATCCTGCCCAGCAAGGTTCTCTTGCTGCTTGCCCAGCTCCTGCATCTTTCCCATAGCAGCACTGAAACGTTCTTCTACCGCCACCTGCCAGCTTCTGGCAAATCCAATGCCATTTATGCCAAGTGTTGGCTGGTGCATCTGCCCTGCCTGCACCTCTACTACCGCCTTGCTGAGCTTGGCCAGGCCTCTCACCAGCATTAGAGCATCCCCTGCCATGCCGC
Full Trace Sequence: GGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGATTGCTATTTGCTTTTTTGGCTGTATGCTGCCCCAGGTCCGGCACTGTCACGGACATTTCCAAATAAGGCCCCATTGTCCCTTTCAACCGACAGGTCAGGATGGAAAGAGCTGCCTGTTTGCCCCTGACCCCTGTAAGATGCATCATTGCTCTGTGCATCAACCTCACTGTGGTGCAATTCCTGAAACAGGCTGGAAAAAAGGGAATACTCCATGCCAGCAATCTCTGAAGCTGGCCCAGAGAAGTTGTATTCTGTCTCAATATCCTGCCCAGCAAGGTTCTCTTGCTGCTTGCCCAGCTCCTGCATCTTTCCCATAGCAGCACTGAAACGTTCTTCTACCGCCACCTGCCAGCTTCTGGCAAATCCAATGCCATTTATGCCAAGTGTTGGCTGGTGCATCTGCCCTGCCTGCACCTCTACTACCGCCTTGCTGAGCTTGGCCAGGCCTCTCACCAGCATTAGAGCATCCCCTGCCATGCCGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCCTCAATTTGTTGCAACGAACCGGTCACTATCAGTCCAATAAAATCCATTATTTGGCGCAAAAACTAAAAATGGACCGCGATTCACAACAAACATGACCTGAGGGGGNNAAGANNAAAAGANNNNNGAANAAANNANNNNNNGNNNTAAAANNNNNGNNNGGNNNNNNGNNNNNGAAAAAAAGAAAAAAAGAAAAAAAAAAAAAAAAGGAAGAANAANAAANNNNANNNNNNGNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGATTGCTATTTGCTTTTTT