ORFeome > LOC495520 ORF1 – XORFeome v1.0

LOC495520 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253737
Gene Page ID:
ORF Xenbase ID: 17256273

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128915
Original XGC clone length: 1659

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: D01

Sequences - 5สน (forward) EST

Accession: JZ838974
dbEST ID: 79656676
Trimmed Sequence: ATGGCATTGTGGGCAACTCTCACCCTGGCATTCACATGCCTGGTAGTGGCACAAGCTAAAACGCTTGGCATAGTTCACACAGAGGGCGGATTTGTTGAAGGAACCAATAAGAAGATTGGGATTCTCTTCCCTGACTACATTGATATTTTCAAAGGGATCCCCTTTGCTGCTCCTCCCAAGCCCTTTGAAAAAGCAGAGAAACATCCGGGATGGTCAGGCACCCTGAAAACTGAAGACTACAAGCCGCGCTGTTTGCAAGCCACCATCACCCAAAACAATGTCTTTGGAAGTGTCGATTGTCTCTATCTGAACATTTGGGTACCTCAGACCCGCTCTGCAGTGTCCACAAAACTCCCGGTCATGATCTGGATCTTTGGAGNGGGGTTTTTTACTTGGCAGTGGTCAAGGAGCCAACTTCTTAAACAACTACCTTTATGACGGTGAAGAAATTGCCATACGTGGCAAGGTCATCGTAGTGACCTTCAACTACCGCGTGGGACCGTTGGGATTTCTCAGCACCGGCGACTCCGATGCACCTGGTAACTATGGACTGTGGGATCAGCACATGGCCATCTCCTGGGTGAAGAGGAACATTGCACCGTTTGGCCGGGACCCAAACACATCACCCCAATTCGAGATTCCGCTGGAGGTGCCCGGTGTTTCTCTGCATACTTTAACCCTTACAACTTGGGACTTAATTCACCGGGCCCTCCGCCCAAAATGCGGTTGGAACGGTGCGCATGGGGCCGTCCAAAGGGACCCTCCCAAATGGGCAAAATCCAACCACCTCCCAACCTTCCGATTCCCTGGGGAATGAGGAAGGG
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATTGTGGGCAACTCTCACCCTGGCATTCACATGCCTGGTAGTGGCACAAGCTAAAACGCTTGGCATAGTTCACACAGAGGGCGGATTTGTTGAAGGAACCAATAAGAAGATTGGGATTCTCTTCCCTGACTACATTGATATTTTCAAAGGGATCCCCTTTGCTGCTCCTCCCAAGCCCTTTGAAAAAGCAGAGAAACATCCGGGATGGTCAGGCACCCTGAAAACTGAAGACTACAAGCCGCGCTGTTTGCAAGCCACCATCACCCAAAACAATGTCTTTGGAAGTGTCGATTGTCTCTATCTGAACATTTGGGTACCTCAGACCCGCTCTGCAGTGTCCACAAAACTCCCGGTCATGATCTGGATCTTTGGAGNGGGGTTTTTTACTTGGCAGTGGTCAAGGAGCCAACTTCTTAAACAACTACCTTTATGACGGTGAAGAAATTGCCATACGTGGCAAGGTCATCGTAGTGACCTTCAACTACCGCGTGGGACCGTTGGGATTTCTCAGCACCGGCGACTCCGATGCACCTGGTAACTATGGACTGTGGGATCAGCACATGGCCATCTCCTGGGTGAAGAGGAACATTGCACCGTTTGGCCGGGACCCAAACACATCACCCCAATTCGAGATTCCGCTGGAGGTGCCCGGTGTTTCTCTGCATACTTTAACCCTTACAACTTGGGACTTAATTCACCGGGCCCTCCGCCCAAAATGCGGTTGGAACGGTGCGCATGGGGCCGTCCAAAGGGACCCTCCCAAATGGGCAAAATCCAACCACCTCCCAACCTTCCGATTCCCTGGGGAATGAGGAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATTGTGGGCAACT

Sequences - 3สน (reverse) EST

Accession: JZ838973
dbEST ID: 79656675
Trimmed Sequence: TACACTTGGCAAATCCATATATGTTTGTGCCCAGAATTTGACGTATGGGGAACGCAGGCTCTGCTTCATGGATTGGTAGTTTATCTTGTTGGTGATTTCAAGGTATTGCCCGTTCTCAGTTGAGTAGGCCAGCCAGGGGGTAGGGACGCTGGATTCGCCCGTGTTGGGGTCTCCAGTCGCTGCAAAGTTGGTCCAATAAGCGATCATGAACTGGGCCACATCTCTGTCTTTGGGTCTGTAAGCCAGCGGGGTGGCAAATGGTTTCCCAAACATATACTGCAGGTCATCGGCGTGGTCAGCCCCCACCCAGTTGGGGTAAACAGGCATGCGGGTGGGGTGGCTAAACAAATAACTGTATGTCTTGGCGCCCTTGGCATTCTGGAAATGTAGGGCCAGAGCCTCCTGAGTGGCAGCCAGGAAGACATAGTCTGTTTCCACTTCAACCACCGTCCTCTTCATATCCTCTTGACTGGGATTGGCCCCCCAGCCAGCAGAGTACAGATTGTATGCAATGTCTAGTGCTGGGGAACCCTTTGGCTAGGGTCAAGCCCTGCACCACCTTTCTGACCCTGTTCGCCGCTATTTTATGGAAAAAGGTGGGGTTATAACAAGGCAAAATACACCCCCGGCAAAAAGGTTTCCAATCCCTGTTGTTTAACCCTTGCGAATTTAATCTCCCCCCACCCACCATAAAAAGAAAAAGGTTTCCTCCGCCTCCAACCGCGGGAAAAAAAAATCTCCGGTCCAATTTAAAAGCGGCCCAAAAAAAAGGC
Full Trace Sequence: GGCAAAAAGGCTATGACCATGTAATACGACTCACTATATGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACACTTGGCAAATCCATATATGTTTGTGCCCAGAATTTGACGTATGGGGAACGCAGGCTCTGCTTCATGGATTGGTAGTTTATCTTGTTGGTGATTTCAAGGTATTGCCCGTTCTCAGTTGAGTAGGCCAGCCAGGGGGTAGGGACGCTGGATTCGCCCGTGTTGGGGTCTCCAGTCGCTGCAAAGTTGGTCCAATAAGCGATCATGAACTGGGCCACATCTCTGTCTTTGGGTCTGTAAGCCAGCGGGGTGGCAAATGGTTTCCCAAACATATACTGCAGGTCATCGGCGTGGTCAGCCCCCACCCAGTTGGGGTAAACAGGCATGCGGGTGGGGTGGCTAAACAAATAACTGTATGTCTTGGCGCCCTTGGCATTCTGGAAATGTAGGGCCAGAGCCTCCTGAGTGGCAGCCAGGAAGACATAGTCTGTTTCCACTTCAACCACCGTCCTCTTCATATCCTCTTGACTGGGATTGGCCCCCCAGCCAGCAGAGTACAGATTGTATGCAATGTCTAGTGCTGGGGAACCCTTTGGCTAGGGTCAAGCCCTGCACCACCTTTCTGACCCTGTTCGCCGCTATTTTATGGAAAAAGGTGGGGTTATAACAAGGCAAAATACACCCCCGGCAAAAAGGTTTCCAATCCCTGTTGTTTAACCCTTGCGAATTTAATCTCCCCCCACCCACCATAAAAAGAAAAAGGTTTCCTCCGCCTCCAACCGCGGGAAAAAAAAATCTCCGGTCCAATTTAAAAGCGGCCCAAAAAAAAGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACACTTGGCAAATCCATATATGT